J Med Microbiol 58 (2009), 151-154; DOI: 10.1099/jmm.0.000331-0
© 2009 Society for General Microbiology
ISSN 0022-2615
Analysis of Vibrio cholerae isolates from the Northern Cape province of South Africa
Anthony M. Smith1,
Arvinda Sooka1,
Husna Ismail1,
Sandrama Nadan1,
Noreen Crisp2,
Eunice Weenink3,
Karen H. Keddy1 and
for the Group for Enteric, Respiratory and Meningeal Disease Surveillance in South Africa (GERMS-SA)
1 Enteric Diseases Reference Unit, National Institute for Communicable Diseases and University of the Witwatersrand, Private Bag X4, Sandringham, South Africa
2 Communicable Disease Control, Department of Health, Kimberley, South Africa
3 National Health Laboratory Service, Kimberley, South Africa
Correspondence
Anthony M. Smith
anthonys{at}nicd.ac.za
Vibrio cholerae is a natural inhabitant of the aquatic environment and can be transmitted to humans through drinking water. South Africa (SA) was recently affected by an epidemic of V. cholerae O1, which occurred from 1997 to 2005 and peaked in 2001 (Keddy et al., 2007). This epidemic affected most provinces in the country, but was not described in the Free State province or the Northern Cape province. Vigilance for the disease remains high in the medical community and cases of V. cholerae infection should be investigated because of the public health importance of epidemic cholera. During the SA epidemic in 2000–2002, we identified a number of non-O1, non-O139 V. cholerae strains that were negative for cholera toxin, but were co-circulating in the environment (K. H. Keddy, unpublished results). Non-O1, non-O139 V. cholerae may be associated with mild diarrhoea and localized, contained outbreaks. Although these strains have low epidemic potential, they may be encapsulated and more frequently cause invasive disease. Their presence in the environment also suggests that environmental conditions are optimal for supporting the growth of epidemic V. cholerae O1, which is known to exist in groundwater sources in a viable but non-culturable resting state (Kaper et al., 1995). In the present study, we report on the investigation of non-O1, non-O139 V. cholerae strains isolated in the Northern Cape province of SA during March to April 2007. These strains included one invasive human isolate and ten water isolates.
On 22 March 2007, V. cholerae was isolated from the blood culture of a 25-year-old female admitted to Kimberley Hospital, located in the Northern Cape province of SA. Escherichia coli was cultured from the blood simultaneously. The patient was severely immunosuppressed and presented with abdominal sepsis. She died shortly after hospital admission due to cardiac arrest ascribed to septic shock and multiple organ failure. No further cases of V. cholerae isolation from humans were reported from this area. However, this single human isolation of V. cholerae was closely followed (26 March–8 April) by the isolation of V. cholerae strains from ten water samples taken at various sections of the nearby Vaal and Harts Rivers (Table 1
). All 11 strains were sent to the Enteric Diseases Reference Unit for confirmation of V. cholerae diagnosis and for genotypic analysis. Bacterial strains were confirmed as V. cholerae using standard microbiological identification techniques. Serogrouping was attempted on all strains using the slide agglutination method with polyvalent antisera and mono-specific Inaba and Ogawa antisera, according to the manufacturer's instructions (Murex Biotech). Detection of the cholera enterotoxin gene (ctxA) was performed by PCR using a previously described method (Keasler & Hall, 1993). For this PCR, we used primers as described in the above method and employed 28 cycles of 95 °C for 1 min, 60 °C for 1 min and 72 °C for 1 min. Susceptibility testing to antimicrobial agents (ampicillin, augmentin, trimethoprim, sulfamethoxazole, chloramphenicol, nalidixic acid, ciprofloxacin, tetracycline, kanamycin, streptomycin, imipenem, ceftriaxone, erythromycin and ceftazidime) was determined by the Etest (AB BIODISK), according to the manufacturer's instructions. PFGE analysis of strains was performed using a PulseNet standardized protocol (Cooper et al., 2006) incorporating separate analysis with SfiI and NotI restriction enzymes. The CHEF-DR III system (Bio-Rad Laboratories) was used for PFGE analysis, with an electrophoresis gradient of 6 V cm–1 and a two-block run programmed as follows. Block 1 included an initial switch time (IST) of 2 s to a final switch time (FST) of 10 s, over a run time of 13 h; while block 2 included an IST of 20 s to a FST of 25 s, over a run time of 7 h. Repetitive element sequence-based PCR (REP-PCR) analysis of strains was performed using previously described primers ERIC1R (ATGTAAGCTCCTGGGGATTCAC) and ERIC2 (AAGTAAGTGACTGGGGTGAGCG) in a PCR employing four cycles of 95 °C for 5 min, 40 °C for 5 min and 72 °C for 5 min; followed by 30 cycles of 95 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min (Versalovic et al., 1991). REP-PCR profiles were generated following electrophoretic separation of PCR products on a 1.5 % agarose gel. PFGE and REP-PCR profiles of strains were analysed and compared using the GelCompar II software, version 4.6 (Applied Maths). Dendrograms of the profiles were created using the unweighted pair group method with arithmetic averages, with analysis of banding patterns incorporating the Dice coefficient. Strains sharing 
90 % similarity on a dendrogram were defined as the same clone.
All V. cholerae strains autoagglutinated in saline, therefore serogroup status could not be determined. Autoagglutination was probably due to the presence of bacterial capsule. All strains were PCR-negative for the cholera enterotoxin gene (ctxA), which confirmed that this was not epidemic cholera and strongly suggested that these were V. cholerae non-O1, non-O139 serotypes. Human infections with V. cholerae non-O1, non-O139 serotypes are rare and sporadic cases are generally reported. Previous reports of V. cholerae non-O1, non-O139 septicaemia have included patients in Austria (Halabi et al., 1997), Slovenia (Strumbelj et al., 2005) and Poland (Stypulkowska-Misiurewicz et al., 2006). Our present report describes another such sporadic case of septicaemia caused by non-O1, non-O139 V. cholerae. Our isolation of V. cholerae from a human was closely followed by the isolation of V. cholerae strains from ten water samples taken at various sections of two major rivers which pass through the Northern Cape province of SA. These ten water strains showed a diversity of PFGE profiles (data not shown) and REP-PCR profiles (Fig. 1). Dendrogram analysis distinguished five clones amongst these ten water strains (data not shown). This high level of genetic diversity was expected and is in agreement with numerous studies which have reported extensive genetic diversity among strains of non-O1, non-O139 V. cholerae (Pang et al., 2007). Furthermore, dendrogram analysis differentiated our V. cholerae strains from a cluster of Southern African V. cholerae O1 strains which included V. cholerae O1 from the 1997–2005 SA epidemic, V. cholerae O1 from the 1980s SA epidemic and V. cholerae O1 from the 2006–2007 Namibian outbreak (data not shown); this provided further evidence for the proposed non-O1 serotype status of the current strains. Most of the V. cholerae strains were isolated from water samples taken along the Vaal River. This would not be the first report of V. cholerae in the Vaal River. Recently, Le Roux et al. (2006) described the presence of a genetically diverse population of V. cholerae in the Vaal Barrage. The Vaal Barrage is located far off upstream of the current water sampling sites. Two of our current strains (191499 and 191717) were isolated from water samples taken at the Vaalharts Weir located on the Vaal River. These two strains showed a PFGE profile (data not shown) and a REP-PCR profile (Fig. 1) which were identical to those of the human strain (190511) and also showed antimicrobial susceptibility profiles similar to that of the human strain (Table 1
). These data suggest that the human strain and the strains from the Vaalharts Weir were related. The Vaalharts Weir is a major diversion weir on the Vaal River, from which water is diverted by canals to surrounding areas. The Vaalharts Weir supplies water to the Phokwane municipality (located 44 km away), which in turn serves the local township of Pampierstad, where the patient lived. No information on water quality was available from the Phokwane municipality. The patient lived in a low-cost formal dwelling in an area serviced by a piped municipal water supply. She was unemployed with no recent travel history. Anecdotal evidence suggests that although residents have access to hygienic municipal water, they sometimes still choose to collect water from open canals. Exactly how the patient became infected with V. cholerae remains speculative; however, scientific evidence strongly suggests that the Vaalharts Weir was the source of the infecting strain. This study has highlighted the continued presence of V. cholerae in the Vaal River of SA. Although these environmental strains have low outbreak potential, their presence suggests that environmental conditions are suitable for survival of epidemic V. cholerae O1 in untreated groundwater, and vigilance regarding water quality must be maintained, even in those provinces of SA which previously have not been affected by a cholera epidemic. Although our patient was not infected by epidemic V. cholerae O1, we have shown that in a patient with severe immunosuppression, co-infection with non-epidemic V. cholerae and E. coli can have a devastating and deadly consequence.
View larger version (74K):
[in this window]
[in a new window]
|
Fig. 1. REP-PCR fingerprint patterns of V. cholerae strains. Lanes: 2, strain 190511; 3, strain 191499; 4, strain 191717; 5, strain 191718; 6, strain 191723; 8, strain 191908; 9, strain 192117; 10, strain 192725; 11, strain 192727; 12, strain 192729; 13, strain 193005; 1, 7 and 14, DNA size standard in base pairs (Bioline HyperLadder I).
|
|
ACKNOWLEDGEMENTS
We thank the Epidemiology Unit of the NICD for notifying us of the V. cholerae strains. We thank Dawid Brits of the NHLS Kimberley laboratory for initial diagnosis of the V. cholerae strains. This work was financially supported by the National Institute for Communicable Diseases and the National Health Laboratory Service.
References
Cooper, K. L., Luey, C. K., Bird, M., Terajima, J., Nair, G. B., Kam, K. M., Arakawa, E., Safa, A., Cheung, D. T. & other authors (2006). Development and validation of a PulseNet standardized pulsed-field gel electrophoresis protocol for subtyping of Vibrio cholerae. Foodborne Pathog Dis 3, 51–58.[CrossRef][Medline]
Halabi, M., Haditsch, M., Renner, F., Brinninger, G. & Mittermayer, H. (1997). Vibrio cholerae non-O1 septicaemia in a patient with liver cirrhosis and Billroth-II-gastrectomy. J Infect 34, 83–84.[CrossRef][Medline]
Kaper, J. B., Morris, J. G., Jr & Levine, M. M. (1995). Cholera. Clin Microbiol Rev 8, 48–86.[Abstract/Free Full Text]
Keasler, S. P. & Hall, R. H. (1993). Detecting and biotyping Vibrio cholerae O1 with multiplex polymerase chain reaction. Lancet 341, 1661[CrossRef][Medline]
Keddy, K. H., Nadan, S., Govind, C. & Sturm, A. W. (2007). Evidence for a clonally different origin of the two cholera epidemics of 2001–2002 and 1980–1987 in South Africa. J Med Microbiol 56, 1644–1650.[Abstract/Free Full Text]
Le Roux, W. J. (2006). Population dynamics of Vibrio cholerae in the Vaal Barrage. MSc dissertation, University of Pretoria, South Africa.
Pang, B., Yan, M., Cui, Z., Ye, X., Diao, B., Ren, Y., Gao, S., Zhang, L. & Kan, B. (2007). Genetic diversity of toxigenic and nontoxigenic Vibrio cholerae serogroups O1 and O139 revealed by array-based comparative genomic hybridization. J Bacteriol 189, 4837–4849.[Abstract/Free Full Text]
Strumbelj, I., Prelog, I., Kotar, T., Dovecar, D., Petras, T. & Socan, M. (2005). A case of Vibrio cholerae non-O1, non-O139 septicaemia in Slovenia, imported from Tunisia, July 2005. Euro Surveill 10, E051020
Stypulkowska-Misiurewicz, H., Pancer, K. & Roszkowiak, A. (2006). Two unrelated cases of septicaemia due to Vibrio cholerae non-O1, non-O139 in Poland, July and August 2006. Euro Surveill 11, E061130
Versalovic, J., Koeuth, T. & Lupski, J. R. (1991). Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res 19, 6823–6831.[Abstract/Free Full Text]
