J Med Microbiol Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Choi, S. Y.
Right arrow Articles by Kim, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Choi, S. Y.
Right arrow Articles by Kim, D. W.
Agricola
Right arrow Articles by Choi, S. Y.
Right arrow Articles by Kim, D. W.
J Med Microbiol 56 (2007), 1460-1466; DOI: 10.1099/jmm.0.47322-0
© 2007 Society for General Microbiology
ISSN 1473-5644

Multilocus sequence typing analysis of Shigella flexneri isolates collected in Asian countries

Seon Young Choi1,2, Yoon-Seong Jeon1,3, Je Hee Lee1,2, Boram Choi1, Sun Hwa Moon1, Lorenz von Seidlein1, John D. Clemens1, Gordon Dougan4, John Wain4, Jun Yu4, Je Chul Lee5, Sung Yong Seol5, Bok Kwon Lee6, Jae-Hoon Song7, Manki Song1, Cecil Czerkinsky1, Jongsik Chun1,2,3 and Dong Wook Kim1

1 International Vaccine Institute, San 4-8 Bongcheon 7 dong, Kwanak gu, Seoul 151-818, Republic of Korea

2 School of Biological Sciences, Seoul National University, Seoul 151-742, Republic of Korea

3 Interdisciplinary Program of Bioinformatics, Seoul National University, Seoul 151-742, Republic of Korea

4 The Wellcome Trust Sanger Institute, Hinxton, Cambridgeshire CB10 1SA, UK

5 School of Medicine, Kyungpook National University, Daegu 700-422, Republic of Korea

6 Laboratory of Enteric Infections, Department of Microbiology, National Institute of Health Korea, Republic of Korea

7 Division of Infectious Disease, Samsung Medical Center, Seoul, Republic of Korea

Correspondence
Dong Wook Kim
dwkim{at}ivi.int

Received 30 March 2007
Accepted 6 July 2007


The multilocus sequence typing scheme used previously for phylogenetic analysis of Escherichia coli was applied to 107 clinical isolates of Shigella flexneri. DNA sequencing of 3423 bp throughout seven housekeeping genes identified eight new allele types and ten new sequence types among the isolates. S. flexneri serotypes 1–5, X and Y were clustered together in a group containing many allelic variants while serotype 6 formed a distinct group, as previously established.


Abbreviations: EIEC, enteroinvasive E. coli; MLST, multilocus sequence typing; ST, sequence type.

The GenBank/EMBL/DDBJ accession numbers for the nucleotide sequences of the new allele types identified in this study are EF364101–EF364108 (icd123, EF364101; adk116, EF364102; fumC149, EF364103; fumC145, EF364104; purA98, EF364105; purA96, EF364106; purA97, EF364107; purA95, EF364108).

A full list of clinical S. flexneri isolates subjected to MLST analysis in this study and a phylogenetic tree generated by the neighbour-joining method for S. flexneri are available as supplementary material with the online version of this paper.


    INTRODUCTION
 TOP
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Shigellosis, a disease characterized by the destruction of the colonic epithelium in humans, is caused by Shigella spp. The estimated annual incidence of shigellosis exceeds 150 million cases worldwide and it is responsible for 1 million deaths per year mainly in the developing world (Kotloff et al., 1999). However, a recent report based on the disease burden and epidemiology of shigellosis in six Asian countries suggests that the actual number of deaths due to this infection might be less than previously assumed in this area (von Seidlein et al., 2006).

A total of 50 serotypes based on O-antigenic structure are recognized within the genus. There are four subtypes or species: Shigella dysenteriae (subtype A), Shigella flexneri (subtype B), Shigella boydii (subtype C) and Shigella sonnei (subtype D). Twenty and 15 serotypes have been defined for S. boydii and S. dysenteriae, respectively. All S. sonnei strains fall into a single serotype and S. flexneri is characterized by 14 serotypes. Many typing methods, including multilocus enzyme electrophoresis and multilocus sequence typing (MLST) using different sets of genes, have shown that Shigella spp. belong to the Escherichia coli superfamily, consisting of three main clusters and a number of outliers (Escobar-Paramo et al., 2003; Pupo et al., 2000; Wirth et al., 2006; Yang et al., 2007). S. flexneri serotypes 1–5, X and Y belong to the main cluster 3 (C3) along with S. boydii 12. S. flexneri 6 and S. boydii 2 and 4 belong to the subcluster 3 (SC3) of the main cluster 1, while the majority of S. dysenteriae and S. boydii (1, 3, 6, 8, 10 and 18) belong to the subclusters 1 and 2 (SC1, SC2) of the main cluster 1, respectively. S. flexneri variant Y contains the basic O-antigen of tetrasaccharide N-acetylglucosamine–rhamnose–rhamnose–rhamnose, serotypes 1–5 and X have glucosyl and/or O-acetyl modifications on those sugar residues and serotypes 6 and 6a have a different O-antigen structure from the others (Cheah et al., 1991). The genome sequence analyses of two S. flexneri serotype 2a strains, 2457T and Sf301, one 5b serotype strain, Sf8401, S. sonnei, S. dysenteriae serotype 1 and S. boydii serotype 4 have been completed (Jin et al., 2002; Nie et al., 2006; Wei et al., 2003; Yang et al., 2005). The complete DNA sequences of the large virulence plasmid of Shigella species have also been published (Buchrieser et al., 2000; Jiang et al., 2005).

MLST of bacterial species was first reported in 1998, and today there are several schemes and public websites for more than 33 species in operation (Maiden, 2006). The evolution of E. coli, particularly the development of virulence and the origin of pathogenic strains, has been studied using MLST analysis (Wirth et al., 2006). The free-access MLST database of E. coli is based on analysis of 462 globally distributed strains including the 72 ECOR collection, and data are continuously being added. By MLST analysis, pathogenic enterohaemorrhagic E. coli, enteropathogenic E. coli, enteroinvasive E. coli (EIEC) and Shigella appear to have originated independently and have been continually evolving from several lineages (Wirth et al., 2006). S. flexneri can be categorized into two sequence type (ST) complexes, each containing a number of STs (Wirth et al., 2006). According to this classification, S. flexneri serotypes 1–5 and variants X and Y make up the ST245 complex, and serotypes 6 and 6a belong to the ST243 complex. However, this study focused on various strains of E. coli in general and only one strain of each serotype of Shigella spp. was included. Detailed analysis of more clinical isolates is therefore warranted for phylogenetic analysis of Shigella spp. and hence we applied the MLST scheme to a sample of S. flexneri isolates collected mainly in Korea and Asian countries since the 1980s. We found that ST245 is common throughout S. flexneri serotypes 1–4 and X and confirmed that S. flexneri serotypes 6 and 6a formed a distinct group from other serotypes. Approximately 10 % of the S. flexneri isolates were represented by new STs and this suggests that there are many variable STs yet to be identified in this species.


    METHODS
 TOP
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Strains. A total of 107 clinical S. flexneri isolates collected in Korea, China, the Philippines, Singapore, Sri Lanka and Taiwan were transported to the International Vaccine Institute, Seoul, Korea (Supplementary Table S1 in JMM Online). Sixty-seven isolates were collected throughout Korea from 1981 to 2000 (Jeong et al., 2003; Kim et al., 2004; Seol et al., 2006), 17 were collected from Hebei Province, China, in 2002 (von Seidlein et al., 2006), and 23 isolates were collected from the Philippines, Singapore, Sri Lanka and Taiwan in 2002. The isolates were grown at 37 °C overnight in trypticase soy broth or agar as required and serotyped by slide agglutination (Denka Seiken). The genome sequences of S. flexneri serotype 2a strain 2457T (Wei et al., 2003), Sf301 (Jin et al., 2002) and serotype 5b strain Sf8401 (Nie et al., 2006) were entered into MLST analysis after generating allele types in silico. Two laboratory strains, S. flexneri serotype 2a YSH6000 (Ohya et al., 2005) and serotype 5a M90T (Allaoui et al., 1992), were also included in this analysis.

Genomic DNA preparation, DNA sequencing and MLST analysis. Genomic DNA was prepared from agar-grown cultures using the Prepman Ultra kit (Applied Biosystems). Seven housekeeping genes were amplified using the primers and PCR conditions described previously (http://web.mpiib-berlin.mpg.de/mlst/dbs/Ecoli/documents/primersColi_html) (Wirth et al., 2006) for MLST analysis: adk (adenylate kinase), fumC (fumarate hydratase), gyrB (DNA gyrase), icd (isocitrate/isopropylmalate dehydrogenase), mdh (malate dehydrogenase), purA (adenylosuccinate dehydrogenase) and recA (ATP/GTP binding motif). The purified PCR products were sequenced in both directions using a Big Dye cycle sequencing kit (Applied Biosystems) and sequencing was performed on an ABI 3770 automatic sequencer according to the manufacturer's instructions. Sequence data for each isolate were added to a group of known sequences to be aligned simultaneously and edited through jPHYDIT (Jeon et al., 2005). Allele type numbers were assigned by comparing the sequences to those in the E. coli MLST database. New ST numbers were assigned to novel STs that included new allele type(s) and/or new combination of allele types. Phylogenetic trees were constructed with combined sequences using BioNumerics software (Applied Maths) by the neighbour-joining method, based on distances estimated using the Jukes and Cantor coefficient (Holmquist et al., 1972). Minimal spanning trees were generated in BioNumerics based on the degree of allele sharing.


    RESULTS AND DISCUSSION
 TOP
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Eight new allele types (adk, 1; fumC, 2; icd, 1; purA, 4) were found among the 107 clinical isolates and 2 laboratory strains of S. flexneri. Moreover, 10 new STs were identified which contained the new allele type(s) and/or new combinations of known allele types. Two ST complexes were reported in S. flexneri previously as shown in Table 1Go (Wirth et al., 2006). ST145 (allele types 1,10,1,1,1,1,1 in the order of adk, fumC, gyrB, icd, mdh, purA and recA,) and ST262 (1,6,1,1,1,1,1) that fell in the ST243 complex were recognized in S. flexneri serotypes 6 and 6a. Other serotypes of S. flexneri were grouped in the ST245 complex (ST245 : 6,61,6,11,13,3,50). Nine new STs differing in one to three allele loci from ST245 were identified in this study (Tables 2Go and 3Go). In the study of Wirth et al. (2006), ST245 was found in serotypes 1a, 1b, 3a, 3c, 4b and X of S. flexneri; this work confirms that a number of isolates of serotypes 2a, 2b, 3b, 4a and 4c (antigenic formula IV:7,8) also fell in this ST (Tables 2Go and 3Go).


View this table:
[in this window]
[in a new window]

 
Table 1. Previously reported results of MLST analysis of S. flexneri strains (Wirth et al., 2006)

Allele numbers for each locus are shown.

 

View this table:
[in this window]
[in a new window]

 
Table 2. MLST results of 107 clinical isolates and 3 laboratory strains (YSH6000, M90T and Sf8401) of S. flexneri analysed in this study

 

View this table:
[in this window]
[in a new window]

 
Table 3. MLST STs found in S. flexneri

New STs identified in this study and ST245 and ST145 found in this study are shown in bold. STs previously reported but not found in this study are shown in plain text.

 
Novel STs associated with serotypes

The new STs found in this study and the variation sites of each allele are listed in Tables 3Go and 4Go. One of the serotype 1b isolates (IB012) which originated in Korea in 1991 was typed as ST627 on the basis of variation in the purA locus (purA97) at nt 477 (T to C). Among serotype 2a isolates ST626 was found in a representative (IB047) from Taiwan, characterized by variation at nt 449 in the adk locus. A further new allele type, 149, was identified in the fumC locus of one of the serotype 2a isolates (IB037) from China. This isolate contained a repeat of six nucleotides (ATGAAC, nt 316–321) between nt 321 and 322 which gave rise to a new ST, ST651. A laboratory strain, YSH6000, of serotype 2a contained a new allele type, purA98, which differed in one nucleotide (position 633) from the common allele type purA3, resulting in ST633.


View this table:
[in this window]
[in a new window]

 
Table 4. Variable site alignment of the MLST alleles of S. flexneri

STs found in this study are shown in bold. Nucleotide position numbers above the sequences are counted from the translation start codon of each gene.

 
We analysed 17 serotype 3a isolates: one from the Philippines (in 2002) and 16 Korean isolates (1986 and 1987). The Philippines isolate was assigned ST628; this ST did not contain new allele types, but was composed of a new combination of previously recognized allele types. Allele recA55, which was found in serotype 4a in a previous study (Wirth et al., 2006), was identified in this isolate. The Korean serotype 3a also contained recA55 but had an additional new allele, fumC145, and defined ST629.

All other serotypes of S. flexneri contained icd11 while serotype 5, 5a, and 5b isolates contained icd66 or icd123, which have common variation sites at positions 207 and 258 but differ at position 625 (Table 4Go); M90T, a laboratory strain of serotype 5a, contained allele type icd123, which differed by two nucleotides (207 and 258) from the common allele type icd11 of the ST245 complex. Allele fumC74, with a variation site at nt 578, was also identified in M90T, resulting in a new ST, ST631. S. flexneri 5b strain Sf8401, for which the genome sequence is available (Nie et al., 2006), contained the same allele type icd123 as M90T but differed from M90T in the fumC locus, and was assigned to ST634. The icd locus might be useful for differentiating serotype 5 from other serotypes or for further analyses such as single nucleotide polymorphism analysis for S. flexneri. Although ST245 is common in other serotypes of S. flexneri as indicated above, it was not found in serotype 5 and subtype isolates (M1356, M90T and Sf8401) investigated here (Allaoui et al., 1992; Nie et al., 2006; Wirth et al., 2006). Nevertheless, since serotype 5 strains are rarely isolated (3 of 1976 clinical isolates in the report of von Seidlein et al., 2006), further clinical isolates should be examined before the absence of ST245 can be confirmed.

The single isolate of serotype Y tested was assigned to ST630 characterized by allele mdh6, which was found by Wirth et al. (2006) in five strains of S. boydii (ST149 complex) and one EIEC strain (ST250 complex), but not in S. flexneri. A new allele type of the purA locus was found in ST630 (purA95) and recA7 that was not previously found in S. flexneri but was present in all S. sonnei strains and some S. dysenteriae strains (Wirth et al., 2006). Although ST630 cannot be included in the ST245 complex since ST245 and ST630 differed by more than three loci, it remains clear that the two STs are closely related.

We identified a new allele type, purA96, in a serotype 6 S. flexneri isolate from Taiwan (C to T at nt 453), resulting in an ST632. The STs of four serotype 6 isolates, including ST632, fell in the ST243 complex, which is distinct from the ST245 complex. Some previously reported STs were not found in this study (Table 3Go), perhaps due to the geographical difference and limited duration of the strain collection.

Phylogenetic analysis

The distribution of each of the S. flexneri STs in the minimal spanning tree is shown in Fig. 1Go, and the phylogenetic tree generated by the neighbour-joining method is shown in supplementary Fig. S1 in JMM Online. Both analyses showed that the ST245 complex and the ST243 complex are distinct groups. Since serotype Y is considered a parental form of other serotypes, analysis of more Y isolates may provide helpful information on the origin of S. flexneri. Given that ST245 is found in various serotypes and several STs could be recognized within a serotype, categorizing each serotype according to the STs was not possible. However, serotype 5 and subtype strains constitute a separate lineage within the ST245 complex by both analysis methods.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 1. Distribution of STs within two ST complexes (ST245 and ST243) of S. flexneri in a minimal spanning tree. Thick black lines indicate the connection between STs sharing six alleles. The dotted line between ST245 and ST630 indicates that they share four alleles. STs identified in this study are shown in bold. ST243, which includes S. boydii 1, 3, 6, 8, 10 and 18 and S. dysenteriae 5 and 7, is not shown in the ST243 complex tree.

 
Along with the chromosomal loci analysis, the evolution of the virulence plasmid of Shigella and EIEC has been extensively studied (Lan et al., 2001, 2003; Yang et al., 2007). Here, we focused on the chromosomal loci according to the MLST analysis scheme of E. coli. It is important to combine the analysis of the chromosomal loci as well as the analysis of the virulence plasmid in the future for better understanding of the origin and pathogenicity of Shigella spp. Two hypotheses are suggested for the origin of Shigella spp. from the ancestral E. coli. Escobar-Paramo et al. (2003) concluded from the sequence analysis results of comparison of four chromosomal genes and three virulence plasmid genes that a single transfer of the virulence plasmid occurred into an ancestral E. coli, which diversified into Shigella and EIEC (Escobar-Paramo et al., 2003). In contrast, Reeves and colleagues proposed multiple origins of Shigella from the MLST results of eight housekeeping genes (Lan & Reeves, 2002; Pupo et al., 2000), and, most recently, Yang et al. (2007) suggested a compromise hypothesis of lateral transfer of the virulence plasmid among E. coli, EIEC and Shigella. However, those studies included only single or two representatives of each serotype and used different analysis methods. To understand the origin of Shigella spp., a unified and more expanded analysis method is essential as well as the inclusion of more strains. Since the diversity of ST complexes of Shigella spp. is less complicated compared to other pathogenic E. coli (enterohaemorrhagic E. coli and enteropathogenic E. coli) (Wirth et al., 2006), it would be feasible to analyse the evolutionary history of Shigella spp. starting with closely related groups or species such as S. flexneri and S. sonnei and expanding to other groups or species. A good model would be the report of the evolutionary history of Salmonella enterica serovar Typhi (Roumagnac et al., 2006), in which the sequence variations of 200 gene fragments from 105 representative globally collected strains of Salmonella Typhi were analysed. A similar approach was applied to an E. coli collection (Hommais et al., 2005). For the application of such analysis methods, it is important to have a set of globally and chronologically collected representative Shigella strains. We expect that some isolates from this study will provide useful information for further analysis. We have collected around 3000 isolates of Shigella spp. anticipating identification of the more informative strains among them.

IncHI1 plasmid

Wei et al. (2003) reported that pSf-R27, a Salmonella enterica serovar Typhi R27-like plasmid, was found in S. flexneri 2a 2457T during genome sequencing of this strain, but not in the other 142 isolates (Wei et al., 2003). PCR primers (incH-F, CGAAATCGGTCCAACCCATTG; incH-R, CGACAACTCATCAGAAGCGTCAAC) specific to repHI1A of R27 (Wain et al., 2003) were used to screen for the presence of pSf-R27 among our S. flexneri isolates; however, no isolates contained this plasmid.


    ACKNOWLEDGEMENTS
 
We thank Philippe J. Sansonetti and Claude Parsot (Institut Pasteur, Paris, France) for providing strain M90T and C. Sasakawa (Tokyo University, Japan) for strain YSH6000. This work was supported by the International Vaccine Institute, the Swedish International Development Cooperation Agency (SIDA) and the Korean Ministry of Education. S.-Y. C., J. H. L. and D. W. K. were supported by grant R01-2006-000-10255-0 from the Basic Research Program of the Korea Science and Engineering Foundation. G. D., J. W. and J. Y. are funded by the Wellcome Trust of Great Britain.


    REFERENCES
 TOP
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Allaoui, A., Mounier, J., Prevost, M. C., Sansonetti, P. J. & Parsot, C. (1992). icsB: a Shigella flexneri virulence gene necessary for the lysis of protrusions during intercellular spread. Mol Microbiol 6, 1605–1616.[CrossRef][Medline]

Buchrieser, C., Glaser, P., Rusniok, C., Nedjari, H., D'Hauteville, H., Kunst, F., Sansonetti, P. & Parsot, C. (2000). The virulence plasmid pWR100 and the repertoire of proteins secreted by the type III secretion apparatus of Shigella flexneri. Mol Microbiol 38, 760–771.[CrossRef][Medline]

Cheah, K. C., Beger, D. W. & Manning, P. A. (1991). Molecular cloning and genetic analysis of the rfb region from Shigella flexneri type 6 in Escherichia coli K-12. FEMS Microbiol Lett 67, 213–218.[Medline]

Escobar-Paramo, P., Giudicelli, C., Parsot, C. & Denamur, E. (2003). The evolutionary history of Shigella and enteroinvasive Escherichia coli revised. J Mol Evol 57, 140–148.[CrossRef][Medline]

Holmquist, R., Cantor, C. & Jukes, T. (1972). Improved procedures for comparing homologous sequences in molecules of proteins and nucleic acids. J Mol Biol 64, 145–161.[CrossRef][Medline]

Hommais, F., Pereira, S., Acquaviva, C., Escobar-Paramo, P. & Denamur, E. (2005). Single-nucleotide polymorphism phylotyping of Escherichia coli. Appl Environ Microbiol 71, 4784–4792.[Abstract/Free Full Text]

Jeon, Y. S., Chung, H., Park, S., Hur, I., Lee, J. H. & Chun, J. (2005). jPHYDIT: a JAVA-based integrated environment for molecular phylogeny of ribosomal RNA sequences. Bioinformatics 21, 3171–3173.[Abstract/Free Full Text]

Jeong, Y. S., Lee, J. C., Kang, H. Y., Yu, H. S., Lee, E. Y., Choi, C. H., Tae, S. H., Lee, Y. C., Cho, D. T. & Seol, S. Y. (2003). Epidemiology of nalidixic acid resistance and TEM-1- and TEM-52-mediated ampicillin resistance of Shigella sonnei isolates obtained in Korea between 1980 and 2000. Antimicrob Agents Chemother 47, 3719–3723.[Abstract/Free Full Text]

Jiang, Y., Yang, F., Zhang, X., Yang, J., Chen, L., Yan, Y., Nie, H., Xiong, Z., Wang, J. & other authors (2005). The complete sequence and analysis of the large virulence plasmid pSS of Shigella sonnei. Plasmid 54, 149–159.[CrossRef][Medline]

Jin, Q., Yuan, Z., Xu, J., Wang, Y., Shen, Y., Lu, W., Wang, J., Liu, H., Yang, J. & other authors (2002). Genome sequence of Shigella flexneri 2a: insights into pathogenicity through comparison with genomes of Escherichia coli K12 and O157. Nucleic Acids Res 30, 4432–4441.[Abstract/Free Full Text]

Kim, S., Kim, J., Kang, Y., Park, Y. & Lee, B. (2004). Occurrence of extended-spectrum ß-lactamases in members of the genus Shigella in the Republic of Korea. J Clin Microbiol 42, 5264–5269.[Abstract/Free Full Text]

Kotloff, K. L., Winickoff, J. P., Ivanoff, B., Clemens, J. D., Swerdlow, D. L., Sansonetti, P. J., Adak, G. K. & Levine, M. M. (1999). Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull World Health Organ 77, 651–666.[Medline]

Lan, R. & Reeves, P. R. (2002). Escherichia coli in disguise: molecular origins of Shigella. Microbes Infect 4, 1125–1132.[CrossRef][Medline]

Lan, R., Lumb, B., Ryan, D. & Reeves, P. R. (2001). Molecular evolution of large virulence plasmid in Shigella clones and enteroinvasive Escherichia coli. Infect Immun 69, 6303–6309.[Abstract/Free Full Text]

Lan, R., Stevenson, G. & Reeves, P. R. (2003). Comparison of two major forms of the Shigella virulence plasmid pINV: positive selection is a major force driving the divergence. Infect Immun 71, 6298–6306.[Abstract/Free Full Text]

Maiden, M. C. (2006). Multilocus sequence typing of bacteria. Annu Rev Microbiol 60, 561–588.[CrossRef][Medline]

Nie, H., Yang, F., Zhang, X., Yang, J., Chen, L., Wang, J., Xiong, Z., Peng, J., Sun, L. & other authors (2006). Complete genome sequence of Shigella flexneri 5b and comparison with Shigella flexneri 2a. BMC Genomics 7, 173[CrossRef][Medline]

Ohya, K., Handa, Y., Ogawa, M., Suzuki, M. & Sasakawa, C. (2005). IpgB1 is a novel Shigella effector protein involved in bacterial invasion of host cells: its activity to promote membrane ruffling via RAC1 and CDC42 activation. J Biol Chem 280, 24022–24034.[Abstract/Free Full Text]

Pupo, G. M., Lan, R. & Reeves, P. R. (2000). Multiple independent origins of Shigella clones of Escherichia coli and convergent evolution of many of their characteristics. Proc Natl Acad Sci U S A 97, 10567–10572.[Abstract/Free Full Text]

Roumagnac, P., Weill, F. X., Dolecek, C., Baker, S., Brisse, S., Chinh, N. T., Le, T. A., Acosta, C. J., Farrar, J. & other authors (2006). Evolutionary history of Salmonella Typhi. Science 314, 1301–1304.[Abstract/Free Full Text]

Seol, S. Y., Kim, Y. T., Jeong, Y. S., Oh, J. Y., Kang, H. Y., Moon, D. C., Kim, J., Lee, Y. C., Cho, D. T. & Lee, J. C. (2006). Molecular characterization of antimicrobial resistance in Shigella sonnei isolates in Korea. J Med Microbiol 55, 871–877.[Abstract/Free Full Text]

von Seidlein, L., Kim, D. R., Ali, M., Lee, H., Wang, X., Thiem, V. D., Canh do, G., Chaicumpa, W., Agtini, M. D. & other authors (2006). A multicentre study of Shigella diarrhoea in six Asian countries: disease burden, clinical manifestations, and microbiology. PLoS Med 3, e353[CrossRef][Medline]

Wain, J., Diem Nga, L. T., Kidgell, C., James, K., Fortune, S., Song Diep, T., Ali, T., Ó Gaora, P., Parry, C. & other authors (2003). Molecular analysis of incHI1 antimicrobial resistance plasmids from Salmonella serovar Typhi strains associated with typhoid fever. Antimicrob Agents Chemother 47, 2732–2739.[Abstract/Free Full Text]

Wei, J., Goldberg, M. B., Burland, V., Venkatesan, M. M., Deng, W., Fournier, G., Mayhew, G. F., Plunkett, G., III, Rose, D. J. & other authors (2003). Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T. Infect Immun 71, 2775–2786.[Abstract/Free Full Text]

Wirth, T., Falush, D., Lan, R., Colles, F., Mensa, P., Wieler, L. H., Karch, H., Reeves, P. R., Maiden, M. C. & other authors (2006). Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol 60, 1136–1151.[CrossRef][Medline]

Yang, F., Yang, J., Zhang, X., Chen, L., Jiang, Y., Yan, Y., Tang, X., Wang, J., Xiong, Z. & other authors (2005). Genome dynamics and diversity of Shigella species, the etiologic agents of bacillary dysentery. Nucleic Acids Res 33, 6445–6458.[Abstract/Free Full Text]

Yang, J., Nie, H., Chen, L., Zhang, X., Yang, F., Xu, X., Zhu, Y., Yu, J. & Jin, Q. (2007). Revisiting the molecular evolutionary history of Shigella spp. J Mol Evol 64, 71–79.[CrossRef][Medline]




This article has been cited by other articles:


Home page
J. Clin. Microbiol.Home page
C.-S. Chiou, H. Watanabe, Y.-W. Wang, W.-L. Wang, J. Terajima, K.-L. Thong, D. C. Phung, and S. K. Tung
Utility of Multilocus Variable-Number Tandem-Repeat Analysis as a Molecular Tool for Phylogenetic Analysis of Shigella sonnei
J. Clin. Microbiol., April 1, 2009; 47(4): 1149 - 1154.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Choi, S. Y.
Right arrow Articles by Kim, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Choi, S. Y.
Right arrow Articles by Kim, D. W.
Agricola
Right arrow Articles by Choi, S. Y.
Right arrow Articles by Kim, D. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL J MED MICROBIOL MICROBIOLOGY J GEN VIROL ALL SGM JOURNALS