HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by McAuliffe, L. Articles by Nicholas, R. A. Search for Related Content PubMed PubMed Citation Articles by McAuliffe, L. Articles by Nicholas, R. A. Agricola Articles by McAuliffe, L. Articles by Nicholas, R. A.

16S rDNA PCR and denaturing gradient gel electrophoresis; a single generic test for detecting and differentiating Mycoplasma species

¹Mycoplasma Group, Department of Statutory and Exotic Bacterial Diseases, Veterinary Laboratories Agency, Weybridge, Surrey KT15 3NB, UK ²NERC Centre for Population Biology, Imperial College London, Silwood Park Campus, Ascot, Berkshire SL5 7PY, UK

Correspondence Laura McAuliffe l.mcauliffe{at}vla.defra.gsi.gov.uk

Received February 25, 2005
Accepted May 2, 2005

Diagnosis of Mycoplasma infection is normally based on culture and serological tests, which can be time-consuming and laborious. A number of specific PCRs have been developed but to date there has not been a single generic test capable of detecting and differentiating mycoplasmas to a species level. This report describes the development of a new diagnostic test based on PCR of the 16S rRNA gene with Mycoplasma-specific primers and separation of the PCR product according to primary sequence using denaturing gradient gel electrophoresis (DGGE). DGGE enabled the differentiation of 67 Mycoplasma species of human and veterinary origin and represents a significant improvement on current tests as diagnosis of Mycoplasma infection can be made directly from clinical samples in less than 24 h.

	INTRODUCTION

TOP INTRODUCTION METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
Mycoplasmas cause a wide range of diseases in both humans and animals and are commonly associated with pneumonia, arthritis, conjunctivitis, infertility and abortion. Specific diagnosis of Mycoplasma infections is often difficult due to the limitations of current diagnostic tests together with the similarities in the diseases that they cause. Mycoplasma are highly fastidious; they typically take weeks to culture and many serological tests are non-specific and insensitive. More recently, PCR has been used to detect a number of Mycoplasma species. However, with over 102 mycoplasmas currently recognized it is not feasible to develop PCR tests for each species and there is a pressing need for a single generic test that can both detect and differentiate mycoplasmas.

Denaturing gradient gel electrophoresis (DGGE) can theoretically detect single-base mutations in DNA (Lerman & Beldjord, 1999; Fischer & Lerman, 1983). The method is based on the prevention of migration of DNA fragments following strand separation caused by chemical denaturants. DGGE has been used extensively for diversity analysis in microbial ecology (Muyzer, 1999) but has not been widely used for the identification and differentiation of pathogenic bacteria. Previously we demonstrated the ability of DGGE to detect and differentiate 27 mycoplasmas of veterinary importance using universal primers for the V3 region of 16S rDNA (McAuliffe et al., 2003). The development of Mycoplasma-specific primers has enabled the application of this method directly to clinical material such as swabs and tissue samples. In addition, we have also extended the scope of the DGGE method to include human, equine, sea mammal, canine and feline Mycoplasma species and a variety of field isolates. The generic nature of the test may lead to the detection of Mycoplasma infections that would be difficult to identify using traditional culture techniques. The applicability of this method to mixed infections is also described.

	METHODS

TOP INTRODUCTION METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
Strains and growth conditions.

The bacterial strains used in this study are listed in Tables 1 and 2. All strains were stored at –70 °C and grown at 37 °C with 5 % CO₂ without aeration. In addition to the type strains used in this study, a number of field strains were also tested using DGGE to ensure that there was intraspecific stability of DGGE profiles. Porcine mycoplasmas were grown in Friis broth and all other mycoplasmas were grown in Eaton's broth as previously described (Nicholas & Baker, 1998).

Design of Mycoplasma-specific primers.

A specific reverse primer for Mollicutes was designed using Primrose (Ashelford et al., 2002). A reverse primer, R543 (5'-ACCTATGTATTACCGCG), for Mycoplasma species was designed by aligning 102 Mycoplasma species. The forward primer of Muyzer et al. (1993), GC341, was used as described below. A 340 bp PCR product was generated with all 72 mycoplasmas tested. The mollicute-specific reverse primer was tested against a range of other bacterial pathogens to ensure specificity as summarized in Table 1. A gradient thermocycler (Bio-Rad, iCycler) was used to test a range of annealing temperatures to ensure specificity. For all further experiments an annealing temperature of 56 °C was used.

DNA extraction and 16S PCR.

Mycoplasma DNA was extracted from a 1 ml aliquot of stationary-phase culture using the Genelute genomic DNA kit according to the manufacturer's instructions (Sigma). DNA was extracted from swabs by swirling the swab in 1 ml of PBS, removing the swab and then using the Genelute kit as described above. DNA was extracted from tissue samples by removing a 1 cm² portion of tissue using sterile instruments, placing it in 1 ml of PBS, homogenizing to produce a suspension and extracting DNA using a Sigma tissue kit according to the manufacturer's instructions. Amplification of the V3 region of the 16S RNA gene was performed according to the method of Muyzer et al. (1993) with minor modifications using the universal bacterial primer GC-341F (5'-CGCCCGCCGCGCGCGGCGGGC GGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG) and the mollicute-specific primer R543. For the PCR, 1 µl lysate was added as a template to 49 µl of a reaction mixture containing 10 mM Tris/HCl (pH 9.0), 1.5 mM MgCl₂, 50 mM KCl, 0.1 % Triton X-100, 0.2 mM of each deoxynucleoside triphosphate and 0.5 U Taqgold (Applied Biosystems). The cycling conditions were: denaturation at 94 °C for 5 min, followed by 30 cycles of 95 °C for 1 min, 56 °C for 45 s and 72 °C for 1 min, and a final extension step of 72 °C for 10 min, and samples were kept at 4 °C until analysis. Aliquots were checked for correct amplification by electrophoresis on a 2 % agarose gel followed by visualization with ethidium bromide under UV illumination.

DGGE.

DGGE was performed using the Ingeny phorU 2x2 apparatus (GRI Molecular Biology). Samples (20 µl) were loaded onto 10 % polyacrylamide/bis (37.5 : 1) gels with denaturing gradients from 30–60 % [where 100 % is 7 M urea and 40 % (v/v) deionized formamide] in 1x TAE electrophoresis buffer (Severn Biotech). Electrophoresis was performed at 100 V at a temperature of 60 °C for 18 h. Gels were then stained with SBYR Gold (Cambridge BioScience) in 1x TAE for 30 min at room temperature and visualized under UV illumination.

	RESULTS

TOP INTRODUCTION METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
Mycoplasma-specific primers

Members of Mycoplasma, Acholeplasma and Ureaplasma groups could be amplified using the Mycoplasma-specific primer R543 and the universal primer GC341; however, members of the related haemoplasma group could not. All 72 Mycoplasma species tested produced a PCR product of approximately 340 bp. Although some non-specific bands were found for Listeria monocytogenes, Bacillus cereus and Staphylococcus aureus at 55 °C, increasing the annealing temperature to 56 °C ensured that the primers amplified only mollicute DNA (Table 1). These products were subjected to DGGE in groups according to host animal. In the majority of cases only one band was seen, indicating that there was no interspecific variation in the amplified sequence. The presence of multiple bands indicated that more than one 16S rDNA operon was present and that there were some sequence differences between the copies. The migration of the bands in the gels is a function of the melting behaviour of the amplicons in the chemical gradient used. A faint background band was sometimes seen on the DGGE gels, it is likely that this is due to a degree of primer-dimer formation and should as such be considered an artefact. The background band was easily differentiated from bands generated from 16S operons as it was faint in intensity, had an irregular shape and was not straight.

Applicability of DGGE directly to clinical samples

In order to test the practicality of DGGE in the clinical laboratory, DNA extraction was performed directly on swabs and tissue samples received for veterinary diagnostic investigations. In total 202 clinical samples were analysed, of which 89 were found to be positive for Mycoplasma infection. Mycoplasma DNA was successfully amplified for DGGE from a wide variety of diagnostic samples including nasal, eye, ear and foot swabs, lung tissue, milk, brain tissue, synovial joint fluid and tissue from an aborted bovine foetus (summarized in Table 2). In order to test the robustness of the procedure on samples that had undergone long-term storage, DGGE was used on bovine lung samples obtained from outbreaks of contagious bovine pleuropneumonia in Botswana and Tanzania that had been frozen at –80 °C for approximately 9 years. DGGE identified Mycoplasma mycoides subsp. mycoides small colony (SC) in eight out of nine samples; culture of the lung samples also yielded M. m. subsp. mycoides SC in eight out of nine samples.

Use of DGGE to detect mixed cultures

DGGE using Mycoplasma-specific primers was particularly useful for detecting mixed cultures. As shown in Fig. 1, analysis of a number of bovine diagnostic samples demonstrated that a mixed infection of Mycoplasma bovirhinis/Mycoplasma alkalescens could be detected easily. In addition, analysis of small ruminant clinical samples showed that mixed infections of Mycoplasma ovipneumoniae/Mycoplasma arginini, M. ovipneumoniae/Mycoplasma conjunctivae and M. conjunctivae/M. arginini could be detected.

View larger version (67K): [in this window] [in a new window]   Fig. 1. Use of DGGE to detect mixed Mycoplasma infections in cattle and sheep: Lane 1, M. bovirhinis and M. alkalescens mixed field strains; lane 2, M. bovirhinis NCTC; lane 3, M. alkalescens NCTC; lane 4, M. ovipneumoniae and M. arginini mixed field strains; lane 5, M. ovipneumoniae and M. conjunctivae mixed field strains; lane 6, M. conjunctivae and M. arginini mixed field strains; lane 7, M. ovipneumoniae NCTC; lane 8, M. conjunctivae NCTC; lane 9, M. arginini NCTC.

Intraspecific stability of DGGE profiles

To test that DGGE profiles were stable within a Mycoplasma species, at least 15 field isolates were compared with the type strain for a number of common veterinary pathogens including Mycoplasma bovis, Mycoplasma agalactiae, M. ovipneumoniae, Mycoplasma gallinarum, Mycoplasma gallinaceum and M. m. subsp. mycoides SC. No intraspecific variability was seen for any Mycoplasma species tested, with the exception of M. m. subsp. mycoides SC and another member of the Mycoplasma mycoides cluster, Mycoplasma capricolum subsp. capripneumoniae. Most (23 of 24) of the M. m. subsp. mycoides SC strains tested gave an identical banding pattern of four bands on DGGE; however, the vaccine strain T144 gave a single band (results not shown). Analysis of M. c. subsp. capripneumoniae indicated some diversity of the 16S operons within the species. Two distinct profiles were seen: a profile identical to that of Mycoplasma capricolum subsp. capricolum was seen in three isolates and a profile of four bands that was distinct from all other profiles was seen for four other isolates (Fig. 2). There was some correlation between the geographical origin of the isolates and their DGGE profiles as isolates from Eritrea (strains T5, T6, T9 and T10) gave a distinctive profile unlike any other Mycoplasma species. Strain F38, which originated in Kenya, strain 44F04 from Turkey and strain 4/2 from Oman all gave identical profiles to M. c. subsp. capricolum.

View larger version (51K): [in this window] [in a new window]   Fig. 2. Intraspecific variability of M. c. subsp. capripneumoniae isolates as shown by DGGE. Lane 1, M. c. subsp. capripneumoniae strain F38; lane 2, M. c. subsp. capripneumoniae strain T5; lane 3, M. c. subsp. capripneumoniae strain T6; lane 4, M. c. subsp. capripneumoniae strain T9; lane 5, M. c. subsp. capripneumoniae strain T10; lane 6, M. c. subsp. capripneumoniae strain 44F04; lane 7, M. c. subsp. capripneumoniae strain 4/2; lane 8, M. m. subsp. mycoides LC; lane 9, M. c. subsp. capricolum.

DGGE of human Mycoplasma species

All 11 human Mycoplasma species tested could be differentiated using DGGE (Fig. 3). Mycoplasma primatum and Mycoplasma fermentans had a similar migration pattern.

View larger version (43K): [in this window] [in a new window]   Fig. 3. DGGE of human Mycoplasma species. Lane 1, Mycoplasma pneumoniae; lane 2, Mycoplasma hominis; lane 3, Mycoplasma faucium; lane 4, Mycoplasma buccale; lane 5, Mycoplasma arthritidis; lane 6, Mycoplasma spermatophilum; lane 7, Mycoplasma salivarum; lane 8, M. primatum; lane 9, Mycoplasma orale; lane 10, Mycoplasma genitalium; lane 11, M. fermentans.

DGGE of avian Mycoplasma species

Sixteen avian mycoplasmas could be easily distinguished using DGGE (summarized in Table 3). Perhaps most importantly, DGGE could distinguish the four avian Mycoplasma species of major economic importance, Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasma meleagridis and Mycoplasma iowae. However, M. iowae and Mycoplasma glycophilum gave similar profiles, but when their full-length 16S sequences were compared, using a two-way BLAST alignment, only 80 % similarity was found (AF412981 M. glycophilum and M24293 M. iowae). Two pigeon Mycoplasma species could not be differentiated using DGGE. Mycoplasma columborale and Mycoplasma columbinasale could not be distinguished and gave the same profile by DGGE. However, analysis of the 16S–23S intergenic spacer (IGS) regions for M. columborale and M. columbinasale (AY796061 and AY796062, respectively) indicated that the species were not highly similar, with only 84 % congruence. BLAST of a shorter IGS on M. columbinasale AJ780986 indicated only 99/122 (81 %) similarity, with gaps of 12/122 (9 %).

Marine isolates

The sea mammal Mycoplasma species Mycoplasma phocarhinis, Mycoplasma phocicerebrale and Mycoplasma phocidae were easily distinguished using DGGE (Fig. 4). Interestingly, a feline mycoplasma, Mycoplasma gateae, gave an identical profile to M. phocicerebrale (Fig. 4). Comparison of DNA 16S–23S IGS sequences for M. gateae and M. phocicerebrale (AF443609 and AY766092, respectively) revealed a high degree of similarity between the two sequences, with similarity of 97 % and gaps of only 1 % as determined using a two-way BLAST alignment (bl2seq, NCBI). Comparison of full-length 16S sequences also revealed congruence between the sequences, with 98 % similarity and no gaps (U15796 and AF304323 for M. gateae and M. phocicerebrale, respectively).

View larger version (29K): [in this window] [in a new window]   Fig. 4. DGGE of sea mammal Mycoplasma species. Lane 1, M. phocicerebrale; lane 2, M. phocirhinis; lane 3, M. phocidae; lane 4, M. gateae.

Bovine Mycoplasma species

DGGE could differentiate all 13 bovine Mycoplasma species tested (as summarized in Table 3). A similar migration pattern was seen in three bovine species, Mycoplasma verecundum, Mycoplasma canadense and M. bovis. However, careful analysis showed that there was a small difference in the distance of migration between the three species. M. bovis produced a different profile to that of the small ruminant mycoplasma M. agalactiae, which can be difficult to distinguish from M. bovis by normal culture and serological tests. Significantly, M. m. subsp. mycoides SC, the causative agent of contagious bovine pleuropneumonia (CBPP) was easily distinguished from all other Mycoplasma species tested and had a characteristic pattern of four bands. M. m. subsp. mycoides SC was also easily distinguished from all other members of the closely related M. mycoides cluster.

Small ruminant Mycoplasma species

Twelve small ruminant Mycoplasma species were analysed using DGGE (summarized in Table 3). All species gave easily distinguishable profiles except for the closely related M. m. subsp. mycoides large colony (LC) and Mycoplasma mycoides subsp. capri, which were identical; similarly, M. cottewii and M. yeatsii could not be differentiated. Analysis of full-length 16S sequences and 16S–23S spacer of M. m. subsp. mycoides LC and M. m. subsp. capri showed a very high degree of similarity (>99 %) between the species, in line with previous studies that have suggested that the two species should be amalgamated into a single species (Pettersson et al., 1996). Similarly Mycoplasma yeatsii and Mycoplasma cottewii were also at least 99 % similar when both full-length 16S and 16S–23S IGS were compared. Significantly, a number of members of the closely related M. mycoides cluster could be differentiated, and Mycoplasma putrefaciens gave a unique profile.

Canine Mycoplasma species

The canine Mycoplasma species Mycoplasma spumans, Mycoplasma opalescens, Mycoplasma cynos and Mycoplasma maculosum were easily distinguished using DGGE (Fig. 5). However, Mycoplasma canis and Mycoplasma edwardii gave highly similar profiles using DGGE; given the high 16S sequence homology between these two species (98 % with no gaps; U73903 and AF412972) this is not unexpected. Interestingly, when M. maculosum was compared with a number of feline isolates, it gave an identical profile to the lion mycoplasma Mycoplasma leopharyngis. Comparison of 16S and 16S–23S IGS sequences for M. maculosum and M. leopharyngis also indicated that the species are identical.

View larger version (26K): [in this window] [in a new window]   Fig. 5. DGGE of canine Mycoplasma species. Lane 1, M. spumans; lane 2, M. opalescens; lane 3, M. maculosum; lane 4, M. edwardii; lane 5, M. cynos; lane 6, M. canis.

Equine Mycoplasma species

The four main Mycoplasma species found in horses, Mycoplasma subdolum, Mycoplasma fastidiosum, Mycoplasma equirhinis and Mycoplasma equigenitalium, were all easily distinguishable using DGGE (Fig. 6). In addition the feline Mycoplasma species Mycoplasma felis, which has been associated with respiratory disease in horses (Ogilvie et al., 1983), was also easy to distinguish from the other equine-associated mycoplasmas using DGGE.

View larger version (25K): [in this window] [in a new window]   Fig. 6. DGGE of equine Mycoplasma species. Lane 1, M. fastidiosum; lane 2, M. subdolum; lane 3, M. felis; lane 4, M. equirhinis; lane 5, M. equigenitalium.

Porcine Mycoplasma species

The four main porcine Mycoplasma species, Mycoplasma hyopneumoniae, Mycoplasma hyorhinis, Mycoplasma hyosynoviae and Mycoplasma flocculare, were easily distinguished using DGGE (summarized in Table 3).

	DISCUSSION

TOP INTRODUCTION METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
DGGE analysis has enabled the detection and differentiation of 67 Mycoplasma species. For at least 40 of these Mycoplasma species there has not previously been a DNA-based diagnostic test available and many have only been identifiable through lengthy culture or serological tests. Previously we showed that DGGE could be used to differentiate 27 Mycoplasma species of veterinary importance (McAuliffe et al., 2003). The current work extends that study to include 67 Mycoplasma species and presents significant improvements to the technique including the use of Mycoplasma-specific primers. Whereas DGGE using universal primers required a media-enrichment step to ensure that only mollicute DNA was amplified (McAuliffe et al., 2003), with the advent of mollicute-specific primers, DGGE can be applied directly to clinical material. As a result of this, Mycoplasma infections can now be diagnosed in less than 24 h compared with 1–2 weeks for traditional culture. The use of Mycoplasma-specific primers has also enabled the detection of mixed cultures, which would have been difficult to detect by conventional methods, as less fastidious species would be outgrown.

DGGE may prove to be particularly useful for human mycoplasmas and is the first generic test capable of differentiating 11 species. Previously a multiplex PCR has been used to differentiate genital Mycoplasma species (Stellrecht et al., 2004) and a reverse line blotting procedure has been used to differentiate five human mollicute pathogens (Wang et al., 2004) but there has not been a single, generic test for other human Mycoplasma species.

Significantly Mycoplasma genitalium and Mycoplasma pneumoniae can be differentiated easily by DGGE, thus demonstrating the specificity of the technique as there is 98 % similarity between the two species based on 16S rDNA sequence homology (Jensen et al., 2003).

A number of mycoplasmas could not be differentiated using DGGE and gave identical profiles. For example, M. m. subsp. capri and M. m. subsp. mycoides LC were indistinguishable, indicating that there was no variation in the 16S rDNA sequence over the V3 region amplified. This may provide further support for the notion that M. m. subsp. mycoides LC and M. m. subsp. capri are in fact the same species (Pettersson et al., 1996).

Some unexpected isolates also gave identical profiles by DGGE, for example the feline mycoplasma M. gateae and the sea mammal species M. phocicerebrale. These results were also supported by comparison of full-length 16S and 16S–23S IGS sequences for the isolates, which also indicated a very high degree of similarity between the species. If these species are closely related it is difficult to explain how they could have been transmitted between two very different hosts, cats and seals, which seem unlikely to have come into close contact with one another. Similarly, the canine mycoplasma M. maculosum showed a high degree of similarity to the lion mycoplasma M. leopharyngis by 16S and 16S–23S IGS analysis and gave identical DGGE profiles. Previous studies have also highlighted the high degree of similarity in 16S sequence and identical biochemical characteristics of these species (Pettersson et al., 2001).

Two canine Mycoplasma species, M. canis and M. edwardii, gave indistinguishable DGGE profiles. This is not unexpected as previous analysis of full-length 16S sequences and 16S–23S IGS sequences found that the species are highly similar (Chalker & Brownlie, 2004). Interestingly, M. cynos could be differentiated from all other canine Mycoplasma species whereas previous studies based on sequence analysis have shown it grouped closely with M. canis and M. edwardii (Chalker & Brownlie, 2004).

Two species, Mycoplasma columbinum and M. columbinasale, could not be distinguished, although previous studies have indicated that they are less than 97 % similar by 16S sequence analysis (Pettersson et al., 2001). Even when cultures were obtained from several different collections the two isolates gave identical profiles. It is likely that the species were previously identified using serological tests, which emphasizes the need for DNA sequencing of historical isolates in collections to ensure that they are correctly identified. Although, whether species should be designated based on serological or molecular methods is still a contentious issue within Mollicutes taxonomy.

DGGE also showed potential for use in molecular-typing studies. Some intraspecific variation in 16S sequences was seen for members of the M. mycoides cluster, M. m. subsp. mycoides SC and M. c. subsp. capripneumoniae. There was some correlation between the origin of the isolates and the profiles obtained for M. c. subsp. capripneumoniae as isolates from Eritrea gave a distinct profile compared with those from Kenya, Turkey and Oman. Previous studies have found that sequencing of the 16S operons of M. c. subsp. capripneumoniae can be a useful tool for epidemiological analysis (Heldtander et al., 2001). DGGE may enable rapid typing of strains and entails much simpler analysis compared with DNA sequencing.

Recently, denaturing HPLC analysis has been used to detect and type bacterial pathogens (Domann et al., 2003; Hurtle et al., 2003) and could theoretically be used as an alternative to DGGE to target single nucleotide polymorphisms in the V3 region of 16S rDNA of Mycoplasma species. However, denaturing-HPLC would require expensive, specialized equipment and more laborious standardization and interpretation compared with DGGE.

In conclusion, DGGE enables the rapid detection and differentiation of Mycoplasma species and can be used to diagnose infections either directly from tissues or from cultured isolates. It is capable of detecting mixed cultures or even new Mollicutes species and is suitable for routine use in the diagnostic laboratory.

	ACKNOWLEDGEMENTS

TOP INTRODUCTION METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
We wish to thank Defra for their continuing support, and Dr Séverine Tasker for the donation of Haemoplasma DNA.

	REFERENCES

TOP INTRODUCTION METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES