|
|
||||||||
1Mycoplasma Group, Department of Statutory and Exotic Bacterial Diseases, Veterinary Laboratories Agency, Weybridge, Surrey KT15 3NB, UK 2NERC Centre for Population Biology, Imperial College London, Silwood Park Campus, Ascot, Berkshire SL5 7PY, UK
Correspondence Laura McAuliffe l.mcauliffe{at}vla.defra.gsi.gov.uk
Received February 25, 2005
Accepted May 2, 2005
Diagnosis of Mycoplasma infection is normally based on culture and serological tests, which can be time-consuming and laborious. A number of specific PCRs have been developed but to date there has not been a single generic test capable of detecting and differentiating mycoplasmas to a species level. This report describes the development of a new diagnostic test based on PCR of the 16S rRNA gene with Mycoplasma-specific primers and separation of the PCR product according to primary sequence using denaturing gradient gel electrophoresis (DGGE). DGGE enabled the differentiation of 67 Mycoplasma species of human and veterinary origin and represents a significant improvement on current tests as diagnosis of Mycoplasma infection can be made directly from clinical samples in less than 24 h.
| INTRODUCTION |
|---|
|
|
|---|
Denaturing gradient gel electrophoresis (DGGE) can theoretically detect single-base mutations in DNA (Lerman & Beldjord, 1999; Fischer & Lerman, 1983). The method is based on the prevention of migration of DNA fragments following strand separation caused by chemical denaturants. DGGE has been used extensively for diversity analysis in microbial ecology (Muyzer, 1999) but has not been widely used for the identification and differentiation of pathogenic bacteria. Previously we demonstrated the ability of DGGE to detect and differentiate 27 mycoplasmas of veterinary importance using universal primers for the V3 region of 16S rDNA (McAuliffe et al., 2003). The development of Mycoplasma-specific primers has enabled the application of this method directly to clinical material such as swabs and tissue samples. In addition, we have also extended the scope of the DGGE method to include human, equine, sea mammal, canine and feline Mycoplasma species and a variety of field isolates. The generic nature of the test may lead to the detection of Mycoplasma infections that would be difficult to identify using traditional culture techniques. The applicability of this method to mixed infections is also described.
| METHODS |
|---|
|
|
|---|
|
|
Design of Mycoplasma-specific primers.
A specific reverse primer for Mollicutes was designed using Primrose (Ashelford et al., 2002). A reverse primer, R543 (5'-ACCTATGTATTACCGCG), for Mycoplasma species was designed by aligning 102 Mycoplasma species. The forward primer of Muyzer et al. (1993), GC341, was used as described below. A 340 bp PCR product was generated with all 72 mycoplasmas tested. The mollicute-specific reverse primer was tested against a range of other bacterial pathogens to ensure specificity as summarized in Table 1. A gradient thermocycler (Bio-Rad, iCycler) was used to test a range of annealing temperatures to ensure specificity. For all further experiments an annealing temperature of 56 °C was used.
DNA extraction and 16S PCR.
Mycoplasma DNA was extracted from a 1 ml aliquot of stationary-phase culture using the Genelute genomic DNA kit according to the manufacturer's instructions (Sigma). DNA was extracted from swabs by swirling the swab in 1 ml of PBS, removing the swab and then using the Genelute kit as described above. DNA was extracted from tissue samples by removing a 1 cm2 portion of tissue using sterile instruments, placing it in 1 ml of PBS, homogenizing to produce a suspension and extracting DNA using a Sigma tissue kit according to the manufacturer's instructions. Amplification of the V3 region of the 16S RNA gene was performed according to the method of Muyzer et al. (1993) with minor modifications using the universal bacterial primer GC-341F (5'-CGCCCGCCGCGCGCGGCGGGC GGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG) and the mollicute-specific primer R543. For the PCR, 1 µl lysate was added as a template to 49 µl of a reaction mixture containing 10 mM Tris/HCl (pH 9.0), 1.5 mM MgCl2, 50 mM KCl, 0.1 % Triton X-100, 0.2 mM of each deoxynucleoside triphosphate and 0.5 U Taqgold (Applied Biosystems). The cycling conditions were: denaturation at 94 °C for 5 min, followed by 30 cycles of 95 °C for 1 min, 56 °C for 45 s and 72 °C for 1 min, and a final extension step of 72 °C for 10 min, and samples were kept at 4 °C until analysis. Aliquots were checked for correct amplification by electrophoresis on a 2 % agarose gel followed by visualization with ethidium bromide under UV illumination.
DGGE.
DGGE was performed using the Ingeny phorU 2x2 apparatus (GRI Molecular Biology). Samples (20 µl) were loaded onto 10 % polyacrylamide/bis (37.5 : 1) gels with denaturing gradients from 3060 % [where 100 % is 7 M urea and 40 % (v/v) deionized formamide] in 1x TAE electrophoresis buffer (Severn Biotech). Electrophoresis was performed at 100 V at a temperature of 60 °C for 18 h. Gels were then stained with SBYR Gold (Cambridge BioScience) in 1x TAE for 30 min at room temperature and visualized under UV illumination.
| RESULTS |
|---|
|
|
|---|
Applicability of DGGE directly to clinical samples
In order to test the practicality of DGGE in the clinical laboratory, DNA extraction was performed directly on swabs and tissue samples received for veterinary diagnostic investigations. In total 202 clinical samples were analysed, of which 89 were found to be positive for Mycoplasma infection. Mycoplasma DNA was successfully amplified for DGGE from a wide variety of diagnostic samples including nasal, eye, ear and foot swabs, lung tissue, milk, brain tissue, synovial joint fluid and tissue from an aborted bovine foetus (summarized in Table 2). In order to test the robustness of the procedure on samples that had undergone long-term storage, DGGE was used on bovine lung samples obtained from outbreaks of contagious bovine pleuropneumonia in Botswana and Tanzania that had been frozen at 80 °C for approximately 9 years. DGGE identified Mycoplasma mycoides subsp. mycoides small colony (SC) in eight out of nine samples; culture of the lung samples also yielded M. m. subsp. mycoides SC in eight out of nine samples.
Use of DGGE to detect mixed cultures
DGGE using Mycoplasma-specific primers was particularly useful for detecting mixed cultures. As shown in Fig. 1, analysis of a number of bovine diagnostic samples demonstrated that a mixed infection of Mycoplasma bovirhinis/Mycoplasma alkalescens could be detected easily. In addition, analysis of small ruminant clinical samples showed that mixed infections of Mycoplasma ovipneumoniae/Mycoplasma arginini, M. ovipneumoniae/Mycoplasma conjunctivae and M. conjunctivae/M. arginini could be detected.
|
Intraspecific stability of DGGE profiles
To test that DGGE profiles were stable within a Mycoplasma species, at least 15 field isolates were compared with the type strain for a number of common veterinary pathogens including Mycoplasma bovis, Mycoplasma agalactiae, M. ovipneumoniae, Mycoplasma gallinarum, Mycoplasma gallinaceum and M. m. subsp. mycoides SC. No intraspecific variability was seen for any Mycoplasma species tested, with the exception of M. m. subsp. mycoides SC and another member of the Mycoplasma mycoides cluster, Mycoplasma capricolum subsp. capripneumoniae. Most (23 of 24) of the M. m. subsp. mycoides SC strains tested gave an identical banding pattern of four bands on DGGE; however, the vaccine strain T144 gave a single band (results not shown). Analysis of M. c. subsp. capripneumoniae indicated some diversity of the 16S operons within the species. Two distinct profiles were seen: a profile identical to that of Mycoplasma capricolum subsp. capricolum was seen in three isolates and a profile of four bands that was distinct from all other profiles was seen for four other isolates (Fig. 2). There was some correlation between the geographical origin of the isolates and their DGGE profiles as isolates from Eritrea (strains T5, T6, T9 and T10) gave a distinctive profile unlike any other Mycoplasma species. Strain F38, which originated in Kenya, strain 44F04 from Turkey and strain 4/2 from Oman all gave identical profiles to M. c. subsp. capricolum.
|
DGGE of human Mycoplasma species
All 11 human Mycoplasma species tested could be differentiated using DGGE (Fig. 3). Mycoplasma primatum and Mycoplasma fermentans had a similar migration pattern.
|
DGGE of avian Mycoplasma species
Sixteen avian mycoplasmas could be easily distinguished using DGGE (summarized in Table 3). Perhaps most importantly, DGGE could distinguish the four avian Mycoplasma species of major economic importance, Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasma meleagridis and Mycoplasma iowae. However, M. iowae and Mycoplasma glycophilum gave similar profiles, but when their full-length 16S sequences were compared, using a two-way BLAST alignment, only 80 % similarity was found (AF412981 M. glycophilum and M24293 M. iowae). Two pigeon Mycoplasma species could not be differentiated using DGGE. Mycoplasma columborale and Mycoplasma columbinasale could not be distinguished and gave the same profile by DGGE. However, analysis of the 16S23S intergenic spacer (IGS) regions for M. columborale and M. columbinasale (AY796061 and AY796062, respectively) indicated that the species were not highly similar, with only 84 % congruence. BLAST of a shorter IGS on M. columbinasale AJ780986 indicated only 99/122 (81 %) similarity, with gaps of 12/122 (9 %).
|
Marine isolates
The sea mammal Mycoplasma species Mycoplasma phocarhinis, Mycoplasma phocicerebrale and Mycoplasma phocidae were easily distinguished using DGGE (Fig. 4). Interestingly, a feline mycoplasma, Mycoplasma gateae, gave an identical profile to M. phocicerebrale (Fig. 4). Comparison of DNA 16S23S IGS sequences for M. gateae and M. phocicerebrale (AF443609 and AY766092, respectively) revealed a high degree of similarity between the two sequences, with similarity of 97 % and gaps of only 1 % as determined using a two-way BLAST alignment (bl2seq, NCBI). Comparison of full-length 16S sequences also revealed congruence between the sequences, with 98 % similarity and no gaps (U15796 and AF304323 for M. gateae and M. phocicerebrale, respectively).
|
Bovine Mycoplasma species
DGGE could differentiate all 13 bovine Mycoplasma species tested (as summarized in Table 3). A similar migration pattern was seen in three bovine species, Mycoplasma verecundum, Mycoplasma canadense and M. bovis. However, careful analysis showed that there was a small difference in the distance of migration between the three species. M. bovis produced a different profile to that of the small ruminant mycoplasma M. agalactiae, which can be difficult to distinguish from M. bovis by normal culture and serological tests. Significantly, M. m. subsp. mycoides SC, the causative agent of contagious bovine pleuropneumonia (CBPP) was easily distinguished from all other Mycoplasma species tested and had a characteristic pattern of four bands. M. m. subsp. mycoides SC was also easily distinguished from all other members of the closely related M. mycoides cluster.
Small ruminant Mycoplasma species
Twelve small ruminant Mycoplasma species were analysed using DGGE (summarized in Table 3). All species gave easily distinguishable profiles except for the closely related M. m. subsp. mycoides large colony (LC) and Mycoplasma mycoides subsp. capri, which were identical; similarly, M. cottewii and M. yeatsii could not be differentiated. Analysis of full-length 16S sequences and 16S23S spacer of M. m. subsp. mycoides LC and M. m. subsp. capri showed a very high degree of similarity (>99 %) between the species, in line with previous studies that have suggested that the two species should be amalgamated into a single species (Pettersson et al., 1996). Similarly Mycoplasma yeatsii and Mycoplasma cottewii were also at least 99 % similar when both full-length 16S and 16S23S IGS were compared. Significantly, a number of members of the closely related M. mycoides cluster could be differentiated, and Mycoplasma putrefaciens gave a unique profile.
Canine Mycoplasma species
The canine Mycoplasma species Mycoplasma spumans, Mycoplasma opalescens, Mycoplasma cynos and Mycoplasma maculosum were easily distinguished using DGGE (Fig. 5). However, Mycoplasma canis and Mycoplasma edwardii gave highly similar profiles using DGGE; given the high 16S sequence homology between these two species (98 % with no gaps; U73903 and AF412972) this is not unexpected. Interestingly, when M. maculosum was compared with a number of feline isolates, it gave an identical profile to the lion mycoplasma Mycoplasma leopharyngis. Comparison of 16S and 16S23S IGS sequences for M. maculosum and M. leopharyngis also indicated that the species are identical.
|
Equine Mycoplasma species
The four main Mycoplasma species found in horses, Mycoplasma subdolum, Mycoplasma fastidiosum, Mycoplasma equirhinis and Mycoplasma equigenitalium, were all easily distinguishable using DGGE (Fig. 6). In addition the feline Mycoplasma species Mycoplasma felis, which has been associated with respiratory disease in horses (Ogilvie et al., 1983), was also easy to distinguish from the other equine-associated mycoplasmas using DGGE.
|
Porcine Mycoplasma species
The four main porcine Mycoplasma species, Mycoplasma hyopneumoniae, Mycoplasma hyorhinis, Mycoplasma hyosynoviae and Mycoplasma flocculare, were easily distinguished using DGGE (summarized in Table 3).
| DISCUSSION |
|---|
|
|
|---|
DGGE may prove to be particularly useful for human mycoplasmas and is the first generic test capable of differentiating 11 species. Previously a multiplex PCR has been used to differentiate genital Mycoplasma species (Stellrecht et al., 2004) and a reverse line blotting procedure has been used to differentiate five human mollicute pathogens (Wang et al., 2004) but there has not been a single, generic test for other human Mycoplasma species.
Significantly Mycoplasma genitalium and Mycoplasma pneumoniae can be differentiated easily by DGGE, thus demonstrating the specificity of the technique as there is 98 % similarity between the two species based on 16S rDNA sequence homology (Jensen et al., 2003).
A number of mycoplasmas could not be differentiated using DGGE and gave identical profiles. For example, M. m. subsp. capri and M. m. subsp. mycoides LC were indistinguishable, indicating that there was no variation in the 16S rDNA sequence over the V3 region amplified. This may provide further support for the notion that M. m. subsp. mycoides LC and M. m. subsp. capri are in fact the same species (Pettersson et al., 1996).
Some unexpected isolates also gave identical profiles by DGGE, for example the feline mycoplasma M. gateae and the sea mammal species M. phocicerebrale. These results were also supported by comparison of full-length 16S and 16S23S IGS sequences for the isolates, which also indicated a very high degree of similarity between the species. If these species are closely related it is difficult to explain how they could have been transmitted between two very different hosts, cats and seals, which seem unlikely to have come into close contact with one another. Similarly, the canine mycoplasma M. maculosum showed a high degree of similarity to the lion mycoplasma M. leopharyngis by 16S and 16S23S IGS analysis and gave identical DGGE profiles. Previous studies have also highlighted the high degree of similarity in 16S sequence and identical biochemical characteristics of these species (Pettersson et al., 2001).
Two canine Mycoplasma species, M. canis and M. edwardii, gave indistinguishable DGGE profiles. This is not unexpected as previous analysis of full-length 16S sequences and 16S23S IGS sequences found that the species are highly similar (Chalker & Brownlie, 2004). Interestingly, M. cynos could be differentiated from all other canine Mycoplasma species whereas previous studies based on sequence analysis have shown it grouped closely with M. canis and M. edwardii (Chalker & Brownlie, 2004).
Two species, Mycoplasma columbinum and M. columbinasale, could not be distinguished, although previous studies have indicated that they are less than 97 % similar by 16S sequence analysis (Pettersson et al., 2001). Even when cultures were obtained from several different collections the two isolates gave identical profiles. It is likely that the species were previously identified using serological tests, which emphasizes the need for DNA sequencing of historical isolates in collections to ensure that they are correctly identified. Although, whether species should be designated based on serological or molecular methods is still a contentious issue within Mollicutes taxonomy.
DGGE also showed potential for use in molecular-typing studies. Some intraspecific variation in 16S sequences was seen for members of the M. mycoides cluster, M. m. subsp. mycoides SC and M. c. subsp. capripneumoniae. There was some correlation between the origin of the isolates and the profiles obtained for M. c. subsp. capripneumoniae as isolates from Eritrea gave a distinct profile compared with those from Kenya, Turkey and Oman. Previous studies have found that sequencing of the 16S operons of M. c. subsp. capripneumoniae can be a useful tool for epidemiological analysis (Heldtander et al., 2001). DGGE may enable rapid typing of strains and entails much simpler analysis compared with DNA sequencing.
Recently, denaturing HPLC analysis has been used to detect and type bacterial pathogens (Domann et al., 2003; Hurtle et al., 2003) and could theoretically be used as an alternative to DGGE to target single nucleotide polymorphisms in the V3 region of 16S rDNA of Mycoplasma species. However, denaturing-HPLC would require expensive, specialized equipment and more laborious standardization and interpretation compared with DGGE.
In conclusion, DGGE enables the rapid detection and differentiation of Mycoplasma species and can be used to diagnose infections either directly from tissues or from cultured isolates. It is capable of detecting mixed cultures or even new Mollicutes species and is suitable for routine use in the diagnostic laboratory.
| ACKNOWLEDGEMENTS |
|---|
|
|
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Garcia-Castillo, M.-I. Morosini, M. Galvez, F. Baquero, R. del Campo, and M.-A. Meseguer Differences in biofilm development and antibiotic susceptibility among clinical Ureaplasma urealyticum and Ureaplasma parvum isolates J. Antimicrob. Chemother., November 1, 2008; 62(5): 1027 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Pritchard, S. F. E. Scholes, A. P. Foster, E. S. E. Mitchell, J. Lawes, G. Ibata, and M. Banks Ulcerative vulvitis and balanitis in sheep flocks Vet Rec., July 19, 2008; 163(3): 86 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Loria, E. Ferrantelli, G. Giardina, L. L. Vecchi, L. Sparacino, F. Oliveri, L. McAuliffe, and R. A. J. Nicholas Isolation and Characterization of Unusual Mycoplasma spp. from Captive Eurasian Griffon (Gyps fulvus) in Sicily J. Wildl. Dis., January 1, 2008; 44(1): 159 - 163. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Wise, M. F. Foecking, K. Roske, Y. J. Lee, Y. M. Lee, A. Madan, and M. J. Calcutt Distinctive Repertoire of Contingency Genes Conferring Mutation- Based Phase Variation and Combinatorial Expression of Surface Lipoproteins in Mycoplasma capricolum subsp. capricolum of the Mycoplasma mycoides Phylogenetic Cluster J. Bacteriol., July 1, 2006; 188(13): 4926 - 4941. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | J MED MICROBIOL | MICROBIOLOGY | J GEN VIROL | ALL SGM JOURNALS |