J Med Microbiol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamasaki, R.
Right arrow Articles by Oguma, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamasaki, R.
Right arrow Articles by Oguma, K.
Agricola
Right arrow Articles by Yamasaki, R.
Right arrow Articles by Oguma, K.
J Med Microbiol 53 (2004), 21-29; DOI: 10.1099/jmm.0.05348-0
© 2004 Society for General Microbiology
ISSN 0022-2615

Immune response in Helicobacter pylori-induced low-grade gastric-mucosa-associated lymphoid tissue (MALT) lymphoma

Rie Yamasaki1, Kenji Yokota2, Hiroyuki Okada3, Shyunji Hayashi4, Motowo Mizuno3, Tadashi Yoshino1, Yoshikazu Hirai4, Daizou Saitou5, Tadaatsu Akagi1 and Keiji Oguma2

1,2,3Departments of Pathology1, Bacteriology2 and Medicine and Medical Science3, Okayama University Graduate School of Medicine and Dentistry, 2-5-1 Shikata-cho, Okayama 700-8558, Japan 4Department of Infection and Immunity, Jichi Medical School, 3311-1 Yakushiji, Minami-kawauchi, Tochigi 326-0498, Japan 5National Cancer Center, Central Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045, Japan

Correspondence Kenji Yokota yokochan{at}md.okayama-u.ac.jp

Received June 10, 2003
Accepted October 21, 2003

We have reported previously that heat-shock protein 60 kDa (hsp60) of Helicobacter pylori is an important antigen in the pathogenesis of gastric mucosa-associated lymphoid tissue (MALT) lymphoma. In order to investigate associations with host immune reactions and hsp60 antigen, CD40 ligand (CD40L) expression and cytokine production were analysed following stimulation with hsp60. To provide a clear antigen-driven immune response, peripheral blood mononuclear cells (PBMC) from patients with low-grade MALT lymphoma and gastritis and those from healthy volunteers were stimulated with recombinant H. pylori hsp60 and H. pylori cell lysate in the presence of cytokines (IL4 and granulocyte-macrophage colony-stimulating factor). mRNA expression was also analysed by a cDNA microarray containing 1100 genes. Expression of CD40L on PBMCs of patients with MALT lymphoma was increased by cytokines or by combination with stimulation with hsp60 antigens. The production of IL4 in PBMC cultures was increased in patients with MALT lymphoma; however, production of IFN-{gamma} was at low levels. DNA microarray analysis indicated increased levels of HLA-DR and integrin mRNAs. In cases of low-grade MALT lymphoma, adaptive immune responses against hsp60 may be enhanced by host factors, such as antigen presentation and T-cell activation, resulting in B-cell proliferation, which can be demonstrated during chronic H. pylori infection.


Abbreviations: APC, antigen-presenting cell; DC, dendritic cell; FDC, follicular dendritic cell; GM-CSF, granulocyte-macrophage colony-stimulating factor; hsp, heat-shock protein; MALT, mucosa-associated lymphoid tissue; PBMC, peripheral blood mononuclear cell; Th, T helper.


    INTRODUCTION
 TOP
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
A close link between Helicobacter pylori infection and the development of gastric mucosa-associated lymphoid tissue (MALT) lymphoma has been established in some studies. H. pylori infection has been confirmed in most cases of MALT lymphoma (Isaacson & Spencer, 1993; Parsonnet et al., 1994; Wotherspoon et al., 1991, 1993). Low-grade MALT lymphomas often regress following the eradication of H. pylori (Bayerdorffer et al., 1995), and they relapse with re-infection with H. pylori (Cammarota et al., 1995; Horstmann et al., 1994).

Heat-shock protein (hsp) is a candidate cross-reacting antigen in microbial infections. Our previous studies have shown that hsp60 is expressed in follicular dendritic cells (FDC) of gastric lymphoid tissues in patients with gastric MALT lymphoma (Kobayashi et al., 1998), and antibodies to human hsp60 have been detected in patients with MALT lymphoma (Kawahara et al., 1999). These results indicate that hsp60 may be associated with the host immune reaction in cases of H. pylori infection and, more specifically, with B-cell proliferation in the gastric mucosa of patients with MALT lymphoma. Some reports have indicated that the proliferation and differentiation of MALT lymphoma tumour cells depends on H. pylori-antigen-specific T cells, as well as on the co-stimulatory signal of the CD40 ligand (CD40L) on CD4+ helper T cells and on the cytokines associated with the T helper 2 (Th-2)-type response (Greiner et al., 1998; Hussell et al., 1993, 1996; Knorr et al., 1999).

Development of DNA microarrays or DNA chips has revolutionized the analysis of gene expression profiles. A DNA microarray can contain thousands of cDNAs or oligonucleotides and, with a single hybridization step, allows systematic comparison of the expression of corresponding genes among samples. The use of DNA microarrays has already allowed the identification of candidate mammalian genes related to carcinogenesis and cell differentiation (Duggan et al., 1999; Khan et al., 1999; Wang et al., 1999).

In the present study, we produced H. pylori hsp60 as a glutathione S-transferase (GST)-fusion protein to investigate the immunological roles of hsp60 as a bacterial antigen. Peripheral blood mononuclear cells (PBMCs) were antigen-specific dendritic cells (DC) induced by hsp60 stimulation in the presence of cytokines [granulocyte-macrophage colony-stimulating factor (GM-CSF) and IL4]. We measured the expression of CD40L on CD4+ cells and the production of Th-1 (IFN-{gamma}) and Th-2 (IL4) cytokines from PBMCs induced by hsp60-driven immune responses via antigen-presenting cells (APC). To detect genes associated with the immune reaction in cases of MALT lymphoma, we also analysed mRNA expression using a cDNA microarray.


    METHODS
 TOP
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Patients.

PBMCs were obtained from 24 H. pylori-positive patients, including 11 patients with low-grade MALT lymphoma (mean age 57 years; range 43–77 years) and 13 patients with gastritis (mean age 51; range 43–65). PBMCs were also obtained from 11 H. pylori-negative healthy volunteers (mean age 45; range 29–55). For the microarray analysis, PBMCs were obtained from 11 H. pylori-positive patients, including six with low-grade gastric MALT lymphoma (mean age 59; range 48–72) and five with gastritis (mean age 42; range 30–56). The five patients with gastritis showed high antibody titres without clinical symptoms. Informed consent was obtained from each of the patients and healthy volunteers.

Diagnosis was based on findings obtained upon endoscopic examination and on histological examination of biopsied gastric specimens. Diagnosis of low-grade MALT lymphoma was confirmed according to the criteria of the revised European–American lymphoma classification (Harris et al., 1994) and was based on the histopathology. Tissue specimens were examined by haematoxylin–eosin stain and immunohistochemistry using antibodies to CD3, CD79a (Dako) and cytokeratin AE1/AE3 (Boehringer Mannheim). All MALT lymphomas showed diffuse neoplastic infiltrates of centrocyte-like cells, lymphoepithelial lesions and an immunophenotype compatible with that of MALT lymphoma. Positive infection with H. pylori was documented by culture, histopathology and the presence of serum antibodies to H. pylori, as confirmed by ELISA. Negative H. pylori infection of healthy controls was defined by seronegativity to H. pylori.

Cloning, expression and purification of recombinant protein.

The amino acid sequence of H. pylori hsp60 was analysed by Genetix software and searched for T-cell epitopes and homology to human hsp60 (Fig. 1). Whole hsp60 (rHSPw) and two partial domains (rHSP2 and rHSP4-5) were selected. Recombinant proteins were expressed as GST-fusion proteins by a PCR cloning method. PCR primers were designed based on sequences published in GenBank. To facilitate cloning, restriction endonuclease cleavage sites were included in the primers. PCR primers 5'-GGAGGATCCCCATGGCAAAAGAAAT CAAATTT and 5'-GGGGTCGACCATCATGCCGCCCATGCCTCC (rHSPw), 5'-TTTGGATCCCCGGCTTGAGGAATATCACG and 5'-TTTGTCGACGGAGAGGTAGCCTCTATCAAA (rHSP2) and 5'-GTCGGATCCCCAGCGAAGAATTGGGCTTG and 5'-TTCGTCGA CCACTTTTTCATCATCGTGTAA (rHSP4-5) were used to amplify parts of the ORF from purified H. pylori ATCC 43504T genomic DNA. The PCR was performed in a 20 µl volume containing ExTaq polymerase (Takara), 5 mM sense and anti-sense oligonucleotide primers and 500 ng H. pylori genomic DNA. The cycling conditions were 25 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s. The amplicon was cut with BamHI and SalI restriction endonucleases and cloned into the vector pGEX-5X-3 (Amersham Pharmacia) by standard techniques; the resultant plasmid was transformed into Escherichia coli DH-5{alpha}. Recombinant protein was expressed at 25 °C in LB broth containing 2 % glucose and ampicillin (100 µg ml-1) at an OD540 of 0.6–0.8 and the mixture was incubated at 37 °C for 3 h. The culture was induced with 0.1 mM IPTG. Cells were harvested by centrifugation at 7000 g for 10 min and resuspended in ice-cold PBS. The bacterial suspension was frozen at -70 °C and thawed and cells were disrupted by sonication on ice for 2 min using a probe sonicator (Astrason) set to full power. Soluble fusion proteins expressed by the GST–hsp clones (rHSPw, rHSP2 and rHSP4-5) were cleaved with thrombin and purified by glutathione–Sepharose 4B (Amersham Pharmacia) affinity chromatography according to the manufacturer's instructions.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. Expression design of recombinant hsp60. Amino acid sequences of H. pylori and human hsp60 were analysed by Genetix software. Whole hsp60 and two partial regions of H. pylori hsp60 were expressed as GST-fusion proteins and were designated rHSPw, rHSP2 and rHSP4-5. rHSPw contained the whole hsp60 (Met1–Met545) coding region, rHSP2 (Glu101–Ser200) contained a domain of the T-cell epitope cluster (Lys159–Thr178) and rHSP4-5 (Ile300–Gly435) contained a domain of the T-cell epitope cluster (Asp396–Gly412) and an upstream region (Ser352–Arg393) common to H. pylori and human hsp60. Anti-human hsp60 mAb LK-2 reacts with both H. pylori and human hsp60 (Kawahara et al., 1999). The epitope recognized by LK-2 is located between residues 383 and 419 of human hsp60 (corresponds to residues Gly356 to Gly392 of H. pylori hsp60; shown by an arrow) (reported by Kobayashi et al., 1998). Asterisks (*) indicate residues that are identical in the human sequence. Boxes indicate T-cell epitopes.

 

Culture of PBMCs.

PBMCs (1 x 106 cells ml-1) from patients and healthy volunteers were cultured in RPMI 1640 with 10 % fetal calf serum in flat-bottomed 24-well plates for 1 week in a 5 % CO2 incubator. To provide a clear antigen-specific immune response to hsp60, the PBMCs were induced DC as APC stimulated by cytokines and recombinant hsp60s (Chen et al., 1998; Tsai et al., 1997; van den Biggelaar et al., 2000). Cytokines were added at the onset of culture at the following final concentrations: 150 pg IL4 ml-1 (R&D Systems) and 400 pg GM-CSF ml-1 (Chemicon International). The initial amount of IL4 added (150 pg ml-1) decreased and was undetectable within 72 h (data not shown). Recombinant H. pylori hsp60s (rHSP2, rHSP4-5 and rHSPw) and H. pylori lysate were then added to the culture at final concentrations of 10 µg ml-1. To assess the proliferation activity of rHSPs, PBMCs from four normal healthy volunteers were stimulated with rHSP2, rHSP4-5, rHSPw and H. pylori cell lysate. Proliferation was assayed by a CellTitre (Promega).

Flow cytometric analysis.

Cultured PBMCs were collected and incubated for 30 min at 4 °C with directly conjugated antibodies using both anti-CD4 (FITC-conjugated) and anti-CD40L (RPE-conjugated) (Dako). Cells were washed with PBS and fixed with 1 % paraformaldehyde in PBS. Expression of CD40L on CD4+ cells was analysed by FACS Calibur (Becton Dickinson). Each measurement analysed a sample containing 10 000 CD4+ cells.

ELISA for cytokines.

After 1 week, levels of IL4 and IFN-{gamma} in culture supernatants were measured using ELISA (BioSource International) following the manufacturer's instructions.

RNA preparation and cDNA microarray analysis.

For microarray analysis, PBMCs obtained from obtained from patients with MALT lymphoma and gastritis were cultured with rHSPw and GM-CSF and IL4 for 1 week. Cultured PBMCs were collected by centrifugation. Total RNA was extracted from the PBMC samples and amplified by the modified method of van Gelder et al. (1990). To obtain the expression profiles of lymphocytes from patients with MALT lymphoma and gastritis, biotin-labelled cRNA was synthesized from sample RNA (2 µg) using the ExpressionChip labelling system (Mergen). Samples were then allowed to hybridize with an oligonucleotide microarray (HO2; Mergen) that contained oligonucleotides based on 1100 genes that primarily encoded cell-surface antigens, cytokines, growth factors, cell differentiation factors, extracellular matrices, interferons, membrane proteins and oncogenes (HO2 ExpressionChip database; http://www.mergen-ltd.com/HO2/HO2finder.asp). Hybridized slides were then incubated with streptavidin, anti-streptavidin primary antibody and Cy3-conjugated secondary antibody (Mergen); incubation proceeded according to the manufacturer's instructions. Detection of signals and statistical analysis of digitized data were respectively carried out with a GMS 418 array scanner (Affymetrix) and GeneSpring 3 2 2 software (Silicon Genetics). Some of the data were saved in a Microsoft Excel file and were analysed using StatView-J 4 11.

Statistical analysis.

Statistical analysis was performed using Student's unpaired t-test.


    RESULTS
 TOP
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Proliferation by rHSP60

PBMCs from four healthy volunteers were stimulated with rHSP60 proteins and H. pylori cell lysate. Proliferation of PBMCs was effectively induced by rHSP2 and rHSPw (Fig. 2). However, only high concentrations of rHSP4-5 caused proliferation of PBMCs. H. pylori lysate did not induce proliferation of PBMCs.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2. Proliferation of PBMCs by rHSP60 stimulation. PBMCs from four normal healthy volunteers were stimulated with rHSP2 (•), rHSP4-5 ({blacksquare}) or rHSPw ({blacktriangleup}) or H. pylori cell lysate ({bigcirc}) and proliferation was assayed. PBMC proliferation was induced by rHSP2 and rHSPw.

 

CD40L expression

Expression of CD40L on CD4+ cells was detected by flow cytometry. PBMCs stimulated with cytokines and additional hsp60 antigens showed higher expression of CD40L in patients with MALT lymphoma. rHSP2 and rHSP4-5 significantly enhanced CD40L expression in patients with MALT lymphoma in comparison with healthy volunteers (Table 1). High percentages of CD40L-positive cells were observed after stimulation with cytokines and co-stimulation with hsp60 antigens from patients with MALT lymphoma; however, such stimulation did not induce CD40L-positive cells in patients with gastritis or in healthy volunteers.


View this table:
[in this window]
[in a new window]
 
Table 1. Percentage of CD40L-positive cells in CD4+ PBMCs under various stimulation regimes
 

Cytokine production

IL4 production by PBMCs was low in cells from patients with gastritis and in healthy controls; almost all cases examined remained under the detection limit (< 2.0 pg ml-1). Cytokine and antigen stimulation induced high IL4 production from PBMCs of patients with MALT lymphoma. IL4 levels stimulated by cytokines and antigens in those with MALT lymphoma were significantly higher than levels in both healthy volunteers and gastritis patients (Fig. 3). Co-stimulation with hsp60 (rHSP2, rHSP4-5 and rHSPw) antigens did not enhance IL4 production. On the other hand, only H. pylori lysate stimulation effectively induced IL4 from PBMCs.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. Production of IL4 from PBMCs. PBMCs (1 x 106 cells ml-1) from patients and healthy volunteers were cultured in RPMI 1640 with added IL4 and GM-CSF. Recombinant H. pylori hsp60 (rHSP2, rHSP4-5 and rHSPw) and H. pylori lysate were then added to the culture at a final concentration of 10 µg ml-1. The concentration of IL4 in culture supernatants of the PBMCs after 1 week was assayed by ELISA. IL4 production associated with gastritis and healthy volunteers was low (generally below the detection limit). IL4 production under various conditions of stimulation of MALT lymphoma cells (filled bars) was higher. Statistical significance: **, P < 0.05; *, P < 0.01.

 

Levels of IFN-{gamma} in different diseases were compared (Fig. 4). IFN-{gamma} levels in gastritis were higher than those in MALT lymphoma. Specifically, significant production of IFN-{gamma} was induced in PBMCs from patients with gastritis that had been stimulated by cytokine and rHSP2. Co-stimulation with rHSPs did not enhance IFN-{gamma} production from PBMCs of patients with MALT lymphoma. On the other hand, co-stimulation with rHSPs enhanced IFN-{gamma} production in PBMCs of patients with gastritis as well as in those of healthy volunteers.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4. Production of IFN-{gamma} from PBMCs. rHSP2 significantly induced IFN-{gamma} production in patients with gastritis. IFN-{gamma} production in MALT lymphoma (filled bars), gastritis (shaded bars) and healthy volunteers (open bars) was analysed with various stimulations. rHSP stimulation with cytokines significantly enhanced IFN-{gamma} production in gastritis and healthy volunteers. Statistical significance: *, P < 0.01.

 

Up- or downregulation of gene expression in patients with MALT lymphoma analysed by microarray

mRNAs showing increased expression in patients with MALT lymphoma (significance, P < 0.01) following rHSPw stimulation are shown in Table 2. Expression of a member of the tumour necrosis factor (TNF) receptor family (the mRNA of TNFRSF1A) was increased in PBMCs from patients with MALT lymphoma. The levels of expression of mRNAs of members of the TNF family are shown in Fig. 5. TNF and lymphotoxin ß mRNA expression was increased in patients with MALT lymphoma. Some Th-1- and Th-2-associated genes are shown in Fig. 6. Expression of IL4 mRNA in MALT lymphoma cases was higher than that of gastritis cases. mRNAs showing decreased expression in MALT lymphoma (significance, P < 0.01) are shown in Table 3.


View this table:
[in this window]
[in a new window]
 
Table 2. Genes induced in MALT lymphoma following rHSPw stimulation
 


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. mRNA expression of the TNF family analysed by microarray. GenBank accession numbers of TNF, lymphotoxin {alpha} and lymphotoxin ß sequences were respectively X01394, D12614 and L11015. The levels of mRNA of TNF and lymphotoxin-ß in MALT lymphoma cases (filled bars) were significantly increased compared with gastritis cases (open bars). Statistical significance: *, P < 0.05.

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6. mRNA expression of Th-1- and Th-2-associated genes analysed by microarray. Th-2-associated IL4 mRNA (accession no. M13982) was increased in patients with MALT lymphoma (filled bars), but was not significantly greater than that in gastritis patients (open bars). IL10 mRNA (accession no. M57627) in gastritis samples was significantly increased compared with MALT lymphoma samples. IL12A mRNA (p35 gene; accession no. M65291) was significantly increased in gastritis. mRNA expression of IL2 (accession no. V00564) was not different in MALT lymphoma and gastritis. Statistical significance: *, P < 0.05.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Genes showing reduced expression in MALT lymphoma following rHSPw stimulation
 


    DISCUSSION
 TOP
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
A large number of tumour-infiltrating T cells have been recognized in MALT lymphoma tissues (Lederman et al., 1992), and proliferation of low-grade MALT lymphoma is dependent on H. pylori-specific tumour-infiltrating T cells rather than on H. pylori itself (Hussell et al., 1993, 1996). CD40L is a co-stimulatory molecule that is expressed on activated CD4+ T cells and induces B-cell activation and differentiation by binding to CD40 on B cells (Lederman et al., 1992). It has been reported that tumour B cells of MALT lymphoma patients are positive for CD40 and that tumour-infiltrating T cells are positive for CD40L (Greiner et al., 1998; Koulis et al., 1997). The growth of MALT lymphoma requires CD40-mediated signalling by T/B cell interaction (Knorr et al., 1999). In the present study, low levels of CD40L expression were increased by rHSP60 stimulation in CD4+ cells from patients with MALT lymphoma; however, rHSP2 and rHSP4-5 enhanced CD40L expression in the presence of cytokines. rHSPw and rHSP2 proliferated PBMCs from healthy volunteers; however, rHSP4-5 did not (Fig. 2). rHSP4-5 contains amino acid sequences that are identical in H. pylori and humans that are recognized by an anti-human hsp60 mAb (LK-2) (Fig. 1). Stimulation with hsp60, which has T-cell epitopes common to the human antigen, may not induce CD40L expression in normal immune reactions, but could have induced expression of CD40L in lymphocytes from patients with MALT lymphoma, resulting in B-cell proliferation and autoimmunity against hsp60 in MALT lymphoma.

Growth of MALT lymphoma also requires Th-2-type cytokines (Greiner et al., 1998). MALT lymphoma-like lesions appeared in the gastric mucosa after long-term Helicobacter felis infection in aged BALB/c mice, which are genetically prone to high production of Th-2-type cytokines and the B cell response (Enno et al., 1995). High levels of Th-2-type cytokines, but only low levels of Th-1-type cytokines, were recognized in MALT lymphoma tissues in vivo (Knorr et al., 1999). In contrast, strong Th-1-type cytokine production and relatively low levels of Th-2-type cytokine production were observed in tumour-infiltrating T cells from two patients with gastric MALT lymphoma after H. pylori stimulation in vitro (Hauer et al., 1997). Our study revealed that PBMCs from patients with gastric MALT lymphoma produced high levels of IL4, but only low levels of IFN-{gamma}. Induction with cytokines (GM-CSF and IL4) induced a high level of IL4 production, indicating that patients with MALT lymphoma are highly sensitive to these cytokines as a host factor. IL4 production by antigen stimulation with hsp60 was limited; however, H. pylori lysate stimulation significantly enhanced IL4 secretion. The Th-2 response in H. pylori-associated MALT lymphoma may depend primarily on host factors and may be enhanced by certain H. pylori antigens.

The local cytokine response in H. pylori-infected patients is upregulated in the Th-1-type, since IFN-{gamma} but not IL4 is increased (Ahlstedt et al., 1999; Lindholm et al., 1998). H. pylori-infected IFN-{gamma} gene-knockout mice showed no inflammatory symptoms and H. pylori-infected IL4 gene-knockout mice showed severe gastritis (Smythies et al., 2000). Expression of class II major histocompatibility complex (MHC) on gastric epithelial cells was induced by H. pylori infection, and IFN-{gamma} also induced class II MHC expression (Engstrand et al., 1989). These observations indicate that IFN-{gamma} might play an important role in induction of the type of gastric inflammation caused by H. pylori. In addition, our data suggest that hsp60 antigens induced IFN-{gamma} production from lymphocytes of gastritis patients and healthy persons. rHSP2 was the most effective at inducing IFN-{gamma} production in patients with gastritis. Recently, some reports have indicated that hsp60 is associated with activation of the NF-{kappa}B signalling pathway via toll-like receptor 2 (TLR2) and TLR4 (Ohashi et al., 2000; Vabulas et al., 2001). These results indicate that hsp60 may play important roles in H. pylori-associated inflammation.

Levels of some mRNAs were increased by stimulation with hsp60 in patients with MALT lymphoma. HLA class II expression is necessary for lymphocyte (T cell) proliferation. PBMCs stimulated by rHSPw showed enhanced mRNA for HLA-DR ({alpha}-chain) in cases of MALT lymphoma. This may be one of the reasons why anti-hsp60 antibody production occurs in patients with MALT lymphoma. Lymphocyte-homing receptors ({alpha}4ß7 integrin) are closely associated with secondary intestinal spread in patients with MALT lymphoma (Dogan et al., 1997). Interestingly, hsp60 stimulation induced ß7 integrin in PBMC mRNA from patients with MALT lymphoma. Intraepithelial and lamina propria lymphocytes in H. pylori-positive gastric mucosa expressed granzyme B at high levels (Oberhuber et al., 1998). The function of granzyme B involves CD8+ T-cell differentiation, specialization and regulation (Sandberg et al., 2001). Therefore, granzyme B function in patients with MALT lymphoma may be of particular importance; however, the details of this association remain unclear. The levels of expression of TNF mRNA and lymphotoxin-ß mRNA in MALT lymphoma cases were significantly increased (P < 0.05) compared with those of gastritis cases (Fig. 6). Both lymphotoxin and TNF are associated with cell death; therefore, these molecules may play important roles in mucosal injury or regulation of immunological reaction in patients with MALT lymphoma.

In contrast, expression of several genes was increased by stimulation with hsp60 in patients with gastritis. Survivin is an anti-apoptosis gene found in half of all high-grade non-Hodgkin's lymphoma cases, but it is not found in low-grade lymphoma cases (Ambrosini et al., 1997, 1998). A decrease in mRNA expression may be one of the features of MALT lymphoma. Cystatin A mRNA was augmented in controls. The cystatin family consists of endogenous cysteine protease inhibitors associated with antigen presentation (Katunuma et al., 1994). The role of cystatin A in H. pylori infection is still unclear; however, it is possible that low expression of cystatin A in MALT lymphoma cases may be associated with production of anti-hsp60 auto-antibodies via APCs. Lymphocyte antigen 75 has also been associated with antigen processing as an endocytic receptor (Jiang et al., 1995). Expression of antigen-processing-associated genes differs between gastritis and MALT lymphoma cases, and these genes may be involved in the development of MALT lymphoma.

A small increase in IL13 mRNA expression was observed in control samples (Table 3). IL13 and IL4 function (i.e. B-cell activation) is similar, but their signalling pathways are independent. IL4 production in culture supernatants was increased and mRNA expression was also increased in patients with MALT lymphoma (Figs 3 and 6). IL4 may play an important role in B-cell proliferation in patients with MALT lymphoma. IL12 induces a Th-1 reaction, but IL10 strongly inhibits Th-1 reactions. An increase in both cytokines was also observed in H. pylori-infected gastric mucosa (Hida et al., 1999), suggesting that H. pylori infection, by inducing a predominantly Th-1 reaction, may be controlled by IL10 production in patients with gastritis. IL2 is also a marker for the Th-1 reaction, whereas H. pylori antigen stimulation did not induce IL2 production from PBMCs (Meyer et al., 2000). IL2 may not be involved in the pathogenesis of MALT lymphoma and gastritis cases.

Adaptive immunity induced by H. pylori infection may progress along different pathways in various diseases. Here, bacterial hsp60 generally induced IFN-{gamma} production; it is possible that bacterial hsp60 may sometimes contribute to partial protective immunity in patients with H. pylori infection. As a primary immune reaction, H. pylori infection can induce production of IFN-{gamma} from lymphocytes or epithelial cells (Meyer et al., 2000; Yasumoto et al., 1992). IFN-{gamma} stimulates macrophage activation, which, in turn, activates naive T cells (Th-0 cells). T-cell responses progress to Th-1 and/or Th-2 differentiation, and adaptive immunity protects against microbial infections (Romagnani, 1996; Wang et al. 2001). During life-long infection with H. pylori, it becomes apparent that many T cells cannot easily be classified into Th-1 and Th-2 subsets in humans. Th-1-dominant immunity can sometimes lead to immune-mediated gastric damage in cases of H. pylori infection. As regards MALT lymphoma, we have previously reported that hsp60 is the immune-dominant antigen, and humoral immunity against hsp60 is strongly induced by H. pylori infection. Normal immunity may not progress to a strong Th-2 reaction because bacterial and human hsp60 share identical amino acid sequences. However, in patients with MALT lymphoma, H. pylori infection induces Th-2-dominant immunity against hsp60, caused by IL4 stimulation and a co-stimulatory signal through CD40L expression. A DNA chip study revealed certain genes that were associated with the immune system pathogenesis of H. pylori infection. Increased levels of mRNAs of HLA-DR and integrin may be associated with T-cell proliferation and lymphocyte infiltration in patients with MALT lymphoma, while granzyme B and the TNF family may possibly be associated with injury of the gastric mucosa. In low-grade MALT lymphoma, adaptive immunity against hsp60 may be enhanced by antigen presentation and by T-cell activation as a host factor, resulting in B-cell proliferation that can be demonstrated during chronic infection. The possibility exists that continuous B-cell proliferation, enhanced by host immune reactions, may lead to the growth of lymphoma cells. Therefore, gastric MALT lymphoma, which is induced by H. pylori infection, may develop by an antigen-driven immune response enhanced by host factors.

In conclusion, hsp60 is an important antigen in H. pylori infection. The antigen-driven immune response to hsp60 was closely associated with the pathogenesis of MALT lymphoma. Genes that are induced or reduced through stimulation by hsp60 may become useful for diagnosis of H. pylori-associated MALT lymphoma. Furthermore, we are continuing to study hsp60 and host immunity in H. pylori infection.


    ACKNOWLEDGEMENTS
 TOP
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
This work was supported by grant number 12670256 of the Ministry of Education, Culture, Sports, Science and Technology, Japan.


    REFERENCES
 TOP
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 

  • Ahlstedt, I., Lindholm, C., Lonroth, H., Hamlet, A., Svennerholm, A. M. & Quiding-Jarbrink, M. (1999). Role of local cytokines in increased gastric expression of the secretory component in Helicobacter pylori infection. Infect Immun 67, 4921–4925.[Abstract/Free Full Text]

  • Ambrosini, G., Adida, C. & Altieri, D. C. (1997). A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med 3, 917–921.[CrossRef][Medline]

  • Ambrosini, G., Adida, C., Sirugo, G. & Altieri, D. C. (1998). Induction of apoptosis and inhibition of cell proliferation by survivin gene targeting. J Biol Chem 273, 11177–11182.[Abstract/Free Full Text]

  • Bayerdorffer, E., Neubauer, A., Rudolph, B., Thiede, C., Lehn, N., Eidt, S. & Stolte, M. (1995). Regression of primary gastric lymphoma of mucosa-associated lymphoid tissue type after cure of Helicobacter pylori infection.MALT Lymphoma Study Group. Lancet 345, 1591–1594.[CrossRef][Medline]

  • Cammarota, G., Montalto, M., Tursi, A., Vecchio, F. M., Fedeli, G. & Gasbarrini, G. (1995). Helicobacter pylori reinfection and rapid relapse of low-grade B-cell gastric lymphoma. Lancet 345, 192. 192.

  • Chen, B., Shi, Y., Smith, J. D., Choi, D., Geiger, J. D. & Mule, J. J. (1998). The role of tumor necrosis factor alpha in modulating the quantity of peripheral blood-derived, cytokine-driven human dendritic cells and its role in enhancing the quality of dendritic cell function in presenting soluble antigens to CD4+ T cells in vitro. Blood 91, 4652–4661.[Abstract/Free Full Text]

  • Dogan, A., Du, M., Koulis, A., Briskin, M. J. & Isaacson, P. G. (1997). Expression of lymphocyte homing receptors and vascular addressins in low-grade gastric B-cell lymphomas of mucosa-associated lymphoid tissue. Am J Pathol 151, 1361–1369.[Abstract]

  • Duggan, D. J., Bittner, M., Chen, Y., Meltzer, P. & Trent, J. M. (1999). Expression profiling using cDNA microarrays. Nat Genet 21 (Suppl.), 10–14.[CrossRef][Medline]

  • Engstrand, L., Scheynius, A., Pahlson, C., Grimelius, L., Schwan, A. & Gustavsson, S. (1989). Association of Campylobacter pylori with induced expression of class II transplantation antigens on gastric epithelial cells. Infect Immun 57, 827–832.[Abstract/Free Full Text]

  • Enno, A., O'Rourke, J. L., Howlett, C. R., Jack, A., Dixon, M. F. & Lee, A. (1995). MALToma-like lesions in the murine gastric mucosa after long-term infection with Helicobacter felis.A mouse model of Helicobacter pylori-induced gastric lymphoma. Am J Pathol 147, 217–222.[Abstract]

  • Greiner, A., Knorr, C., Qin, Y., Schultz, A., Marx, A., Kroczek, R. A. & Muller-Hermelink, H. K. (1998). CD40 ligand and autoantigen are involved in the pathogenesis of low-grade B-cell lymphomas of mucosa-associated lymphoid tissue. Dev Immunol 6, 187–195.[Medline]

  • Harris, N. L., Jaffe, E. S., Stein, H. & 7 other authors (1994). A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood 84, 1361–1392.[Free Full Text]

  • Hauer, A. C., Finn, T. M., MacDonald, T. T., Spencer, J. & Isaacson, P. G. (1997). Analysis of TH1 and TH2 cytokine production in low grade B cell gastric MALT-type lymphomas stimulated in vitro with Helicobacter pylori. J Clin Pathol 50, 957–959.[Abstract/Free Full Text]

  • Hida, N., Shimoyama, T., Jr, Neville, P., Dixon, M. F., Axon, A. T., Shimoyama, T., Sr & Crabtree, J. E. (1999). Increased expression of IL-10 and IL-12 (p40) mRNA in Helicobacter pylori infected gastric mucosa: relation to bacterial cag status and peptic ulceration. J Clin Pathol 52, 658–664.[Abstract]

  • Horstmann, M., Erttmann, R. & Winkler, K. (1994). Relapse of MALT lymphoma associated with Helicobacter pylori after antibiotic treatment. Lancet 343, 1098–1099.

  • Hussell, T., Isaacson, P. G. & Spencer, J. (1993). Proliferation and differentiation of tumour cells from B-cell lymphoma of mucosa-associated lymphoid tissue in vitro. J Pathol 169, 221–227.[CrossRef][Medline]

  • Hussell, T., Isaacson, P. G., Crabtree, J. E. & Spencer, J. (1996). Helicobacter pylori-specific tumour-infiltrating T cells provide contact dependent help for the growth of malignant B cells in low-grade gastric lymphoma of mucosa-associated lymphoid tissue. J Pathol 178, 122–127.[CrossRef][Medline]

  • Isaacson, P. G. & Spencer, J. (1993). Is gastric lymphoma an infectious disease? Hum Pathol 24, 569–570.[CrossRef][Medline]

  • Jiang, W., Swiggard, W. J., Heufler, C., Peng, M., Mirza, A., Steinman, R. M. & Nussenzweig, M. C. (1995). The receptor DEC-205 expressed by dendritic cells and thymic epithelial cells is involved in antigen processing. Nature 375, 151–155.[CrossRef][Medline]

  • Katunuma, N., Kakegawa, H., Matsunaga, Y. & Saibara, T. (1994). Immunological significances of invariant chain from the aspect of its structural homology with the cystatin family. FEBS Lett 349, 265–269.[CrossRef][Medline]

  • Kawahara, Y., Yokota, K., Mizuno, M. & 7 other authors (1999). Antibodies to human gastric epithelial cells and heat shock protein 60 in Helicobacter pylori positive mucosa associated lymphoid tissue lymphoma. Gut 45, 20–23.[Abstract/Free Full Text]

  • Khan, J., Bittner, M. L., Saal, L. H., Teichmann, U., Azorsa, D. O., Gooden, G. C., Pavan, W. J., Trent, J. M. & Meltzer, P. S. (1999). cDNA microarrays detect activation of a myogenic transcription program by the PAX3-FKHR fusion oncogene. Proc Natl Acad Sci U S A 96, 13264–13269.[Abstract/Free Full Text]

  • Knorr, C., Amrehn, C., Seeberger, H., Rosenwald, A., Stilgenbauer, S., Ott, G., Muller Hermelink, H. K. & Greiner, A. (1999). Expression of costimulatory molecules in low-grade mucosa-associated lymphoid tissue-type lymphomas in vivo. Am J Pathol 155, 2019–2027.[Abstract/Free Full Text]

  • Kobayashi, K., Yokota, K., Yoshino, T., Kawahara, Y., Dey, A., Hirai, Y., Oguma, K. & Akagi, T. (1998). Detection of Helicobacter pylori associated antigen and heat shock protein 60 on follicular dendritic cells in the germinal centres of low grade B cell lymphoma of gastric mucosa associated lymphoid tissue (MALT). J Clin Pathol 51, 396–398.[Abstract]

  • Koulis, A., Diss, T., Isaacson, P. G. & Dogan, A. (1997). Characterization of tumor-infiltrating T lymphocytes in B-cell lymphomas of mucosa-associated lymphoid tissue. Am J Pathol 151, 1353–1360.[Abstract]

  • Lederman, S., Yellin, M. J., Krichevsky, A., Belko, J., Lee, J. J. & Chess, L. (1992). Identification of a novel surface protein on activated CD4+ T cells that induces contact-dependent B cell differentiation (help). J Exp Med 175, 1091–1101.[Abstract/Free Full Text]

  • Lindholm, C., Quiding-Jarbrink, M., Lonroth, H., Hamlet, A. & Svennerholm, A. M. (1998). Local cytokine response in Helicobacter pylori-infected subjects. Infect Immun 66, 5964–5971.[Abstract/Free Full Text]

  • Meyer, F., Wilson, K. T. & James, S. P. (2000). Modulation of innate cytokine responses by products of Helicobacter pylori. Infect Immun 68, 6265–6272.[Abstract/Free Full Text]

  • Oberhuber, G., Bodingbauer, M., Mosberger, I., Stolte, M. & Vogelsang, H. (1998). High proportion of granzyme B-positive (activated) intraepithelial and lamina propria lymphocytes in lymphocytic gastritis. Am J Surg Pathol 22, 450–458.[CrossRef][Medline]

  • Ohashi, K., Burkart, V., Flohe, S. & Kolb, H. (2000). Cutting edge: heat shock protein 60 is a putative endogenous ligand of the toll-like receptor-4 complex. J Immunol 164, 558–561.[Abstract/Free Full Text]

  • Parsonnet, J., Hansen, S., Rodriguez, L., Gelb, A. B., Warnke, R. A., Jellum, E., Orentreich, N., Vogelman, J. H. & Friedman, G. D. (1994). Helicobacter pylori infection and gastric lymphoma. N Engl J Med 330, 1267–1271.[Abstract/Free Full Text]

  • Romagnani, S. (1996). Understanding the role of Th1/Th2 cells in infection. Trends Microbiol 4, 470–473.[CrossRef][Medline]

  • Sandberg, J. K., Fast, N. M. & Nixon, D. F. (2001). Functional heterogeneity of cytokines and cytolytic effector molecules in human CD8+ T lymphocytes. J Immunol 167, 181–187.[Abstract/Free Full Text]

  • Smythies, L. E., Waites, K. B., Lindsey, J. R., Harris, P. R., Ghiara, P. & Smith, P. D. (2000). Helicobacter pylori-induced mucosal inflammation is Th1 mediated and exacerbated in IL-4, but not IFN-{gamma}, gene-deficient mice. J Immunol 165, 1022–1029.[Abstract/Free Full Text]

  • Tsai, V., Southwood, S., Sidney, J., Sakaguchi, K., Kawakami, Y., Appella, E., Sette, A. & Celis, E. (1997). Identification of subdominant CTL epitopes of the GP100 melanoma-associated tumor antigen by primary in vitro immunization with peptide-pulsed dendritic cells. J Immunol 158, 1796–1802.[Abstract]

  • Vabulas, R. M., Ahmad-Nejad, P., da Costa, C., Miethke, T., Kirschning, C. J., Hacker, H. & Wagner, H. (2001). Endocytosed HSP60s use toll-like receptor 2 (TLR2) and TLR4 to activate the toll/interleukin-1 receptor signaling pathway in innate immune cells. J Biol Chem 276, 31332–31339.[Abstract/Free Full Text]

  • van den Biggelaar, A. H., Grogan, J. L., Filie, Y., Jordens, R., Kremsner, P. G., Koning, F. & Yazdanbakhsh, M. (2000). Chronic schistosomiasis: dendritic cells generated from patients can overcome antigen-specific T cell hyporesponsiveness. J Infect Dis 182, 260–265.[CrossRef][Medline]

  • van Gelder, R. N., von Zastrow, M. E., Yool, A., Dement, W. C., Barchas, J. D. & Eberwine, J. H. (1990). Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proc Natl Acad Sci U S A 87, 1663–1667.[Abstract/Free Full Text]

  • Wang, K., Gan, L., Jeffery, E. & 8 other authors (1999). Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray. Gene 229, 101–108.[CrossRef][Medline]

  • Wang, J., Blanchard, T. G. & Ernst, P. B. (2001). Host inflammatory response to infection. In Helicobacter pylori Physiology and Genetics, pp. 471–480. Edited by H. L. T. Mobley, G. L. Mendz & S. L. Hazell. Washington, DC: American Society for Microbiology.

  • Wotherspoon, A. C., Ortiz-Hidalgo, C., Falzon, M. R. & Isaacson, P. G. (1991). Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet 338, 1175–1176.[CrossRef][Medline]

  • Wotherspoon, A. C., Doglioni, C., Diss, T. C., Pan, L., Moschini, A., de Boni, M. & Isaacson, P. G. (1993). Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 342, 575–577.[CrossRef][Medline]

  • Yasumoto, K., Okamoto, S., Mukaida, N., Murakami, S., Mai, M. & Matsushima, K. (1992). Tumor necrosis factor {alpha} and interferon {gamma} synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-{kappa}B-like binding sites of the interleukin 8 gene. J Biol Chem 267, 22506–22511.[Abstract/Free Full Text]




    This article has been cited by other articles:


    Home page
    Cancer Epidemiol. Biomarkers Prev.Home page
    L. A. Anderson, R. Pfeiffer, J. L. Warren, O. Landgren, S. Gadalla, S. I. Berndt, W. Ricker, R. Parsons, W. Wheeler, and E. A. Engels
    Hematopoietic Malignancies Associated with Viral and Alcoholic Hepatitis
    Cancer Epidemiol. Biomarkers Prev., November 1, 2008; 17(11): 3069 - 3075.
    [Abstract] [Full Text] [PDF]


    Home page
    J. Bacteriol.Home page
    B. A. Chromy, M. W. Choi, G. A. Murphy, A. D. Gonzales, C. H. Corzett, B. C. Chang, J. P. Fitch, and S. L. McCutchen-Maloney
    Proteomic Characterization of Yersinia pestis Virulence
    J. Bacteriol., December 1, 2005; 187(23): 8172 - 8180.
    [Abstract] [Full Text] [PDF]


    Home page
    J Med MicrobiolHome page
    S.-N. Lin, K. Ayada, Y. Zhao, K. Yokota, R. Takenaka, H. Okada, R. Kan, S. Hayashi, M. Mizuno, Y. Hirai, et al.
    Helicobacter pylori heat-shock protein 60 induces production of the pro-inflammatory cytokine IL8 in monocytic cells
    J. Med. Microbiol., March 1, 2005; 54(3): 225 - 233.
    [Abstract] [Full Text] [PDF]


    This Article
    Right arrow Abstract Freely available
    Right arrow Full Text (PDF)
    Right arrow Alert me when this article is cited
    Right arrow Alert me if a correction is posted
    Right arrow Citation Map
    Services
    Right arrow Email this article to a friend
    Right arrow Similar articles in this journal
    Right arrow Similar articles in PubMed
    Right arrow Alert me to new issues of the journal
    Right arrow Download to citation manager
    Right arrow reprints & permissions
    Citing Articles
    Right arrow Citing Articles via HighWire
    Right arrow Citing Articles via CrossRef
    Right arrow Citing Articles via Google Scholar
    Google Scholar
    Right arrow Articles by Yamasaki, R.
    Right arrow Articles by Oguma, K.
    Right arrow Search for Related Content
    PubMed
    Right arrow PubMed Citation
    Right arrow Articles by Yamasaki, R.
    Right arrow Articles by Oguma, K.
    Agricola
    Right arrow Articles by Yamasaki, R.
    Right arrow Articles by Oguma, K.


    HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
    INT J SYST EVOL MICROBIOL J MED MICROBIOL MICROBIOLOGY J GEN VIROL ALL SGM JOURNALS